Aa Protein Research Articles

The genetic architecture of protein stability

There are more ways to synthesize a 100-amino acid (aa) protein (20100) than there are atoms in the universe. Only a very small fraction of such a vast sequence space can ever be experimentally or computationally surveyed. Deep neural networks are increasingly being used to navigate high-dimensional sequence spaces1. However, these models are extremely complicated. Here, by experimentally sampling from sequence spaces larger than 1010, we show that the genetic architecture of at least some proteins is remarkably simple, allowing accurate genetic prediction in high-dimensional sequence spaces with fully interpretable energy models. These models capture the nonlinear relationships between free energies and phenotypes but otherwise consist of additive free energy changes with a small contribution from pairwise energetic couplings. These energetic couplings are sparse and associated with structural contacts and backbone proximity. Our results indicate that protein genetics is actually both rather simple and intelligible.

Molecular Cloning and Characterization of Scavenger Receptor Class B Type 1 in Grass Carp (Ctenopharyngodon idellus) and Its Expression Profile following Grass Carp Reovirus Challenge

As a member of the pattern recognition receptor (PRR) class, scavenger receptor class B type 1 (SRB1) plays a key role in innate immunity. Grass carp (Ctenopharyngodon idellus) ranks among the most extensively cultivated freshwater aquaculture species in China. However, little is known about the function of SRB1 in C. idellus. In this research study, a SRB1 gene was identified in C. idellus, named CiSRB1. The full-length cDNA of CiSRB1 is 2486 bp long, with an open reading frame (ORF) of 2486 bp encoding a 497 amino acid (aa) protein containing a conserved CD36 domain. The identified genomic DNA length of CiSRB1 is 20,042 bp, including 12 exons and 11 introns. The predictive analysis of protein interactions revealed that CiSRB1 could interact with the outer capsid proteins of typical GCRV strains. The tissue distribution of CiSRB1 exhibited age-dependent characteristics. CiSRB1 displayed the highest expression in the intestines and moderate levels in muscle, spleen, liver, and brain of one-year-old grass carp while maintaining relatively low levels in three-year-old grass carp. Following grass carp reovirus (GCRV) infection, notable upregulation of CiSRB1 transcripts was observed in major immune tissues (gills, intestines, spleen, and liver). Furthermore, significant differences were found between one-year-old and three-year-old grass carp, with lower CiSRB1 expression levels being detected in the older group. Additionally, a distinct response to GCRV infection was observed in one-year-old and three-year-old grass carp. It was found that one-year-old individuals had a mortality rate of up to 84% 6 days post-infection (dpi), whereas all three-year-old counterparts survived after GCRV infection. The analysis of GCRV copy numbers across tissues revealed substantially higher levels in one-year-old grass carp compared with their older counterparts, confirming the existence of age-dependent susceptibility to GCRV infection in grass carp. Combined with these results, it was speculated that the decline in cell-surface CiSRB1 expression with age may impede reovirus binding to host cells, potentially explaining why older grass carp demonstrated enhanced resistance to GCRV infection. This observation accentuates the importance of CiSRB1 in the context of GCRV infection and provides insights into age-dependent susceptibility to reovirus.

PdPANA: phagemid display as peptide array for neutralizing antibodies, an engineered in silico vaccine candidate against COVID-19

The COVID-19 pandemic has tested the technical, scientific, and industrial resources of all countries worldwide. Faced with the absence of pharmacological strategies against the disease, an effective plan for vaccinating against SARS-CoV-2 has been essential. Due to the lack of production means and necessary infrastructure, only a few nations could adequately confront this pathogen with a production, storage, and distribution scheme in place. This disease has become endemic in many countries, especially in those that are developing, thus necessitating solutions tailored to their reality. In this paper, we propose an in silico method to guide the design towards a thermally stable, universal, efficient, and safe COVID-19 vaccine candidate against SARS-CoV-2 using bioinformatics, immunoinformatics, and molecular modeling approaches for the selection of antigens with higher immunogenic potential, incorporating them into the surface of the M13 phage. Our work focused on using phagemid display as peptide array for neutralizing antibodies (PdPANA). This alternative approach might be useful during the vaccine development process, since it could bring improvements in terms of cost-effectiveness in production, durability, and ease of distribution of the vaccine under less stringent thermal conditions compared to existing methods. Our results suggest that in the heavily glycosylated region of SARS-CoV-2 Spike protein (aa 344–583), from its inter-glycosylated regions, useful antigenic peptides can be obtained to be used in M13 phagemid display system. PdPANA, our proposed method might be useful to overcome the classic shortcoming posed by the phage-display technique (i.e., the time-consuming task of in vitro screening through great sized libraries with non-useful recombinant proteins) and obtain the most ideal recombinant proteins for vaccine design purposes.

Genome-wide identification and expressional profile of the Dmrt gene family in the swimming crab (Portunus trituberculatus)

The swimming crab, Portunus trituberculatus is one of crucial aquaculture crabs with significant differences in growth and economic performance between male and female swimming crabs. Consequently, the culture of female populations presents higher economic value. The doublesex and mab-3 related transcription factor (Dmrt) gene family are known to play crucial role in gonad differentiation and development. However, there is limited information about this gene family in Portunus trituberculatus. In this study, we identified seven members of the Dmrt gene family in P. trituberculatus based on the published transcriptome and genome data and designated as Ptdmrt-1, Ptdoublesex (Ptdsx), Ptidmrt-1, Ptdmrt-11E, Ptidmrt-2, Ptdmrt-99B, and Ptdmrt-3 based on the homology analysis results, respectively. These Ptdmrt genes distributed across 6 chromosomes and were predicted to encode 283 aa, 288 aa, 529 aa, 436 aa, 523 aa, 224 aa, and 435 aa protein precursors, respectively. The expression patterns of these dmrt genes were characterized by qRT-PCR and gonad transcriptome data. The results showed that five members (Ptdmrt-99B, Ptdsx, Ptdmrt-1, Ptdmrt-3, and Ptdmrt-11E) were differentially expressed between the testis and ovary. In addition, their expression patterns from zoea 2 to juvenile 1 were characterized by published transcriptome data and the results showed that they were lowly expressed and did not exhibit notable difference except for Ptdsx during early development. Overall, majority of Ptdmrt genes were involved in gonad differentiation in the swimming crab. Current findings provide a solid foundation for further exploration of the roles of these genes in gonad development and differentiation in P. trituberculatus.

Effects of porcine somatotropin administration on the responses to dietary lysine and a near-ideal blend of amino acids on the amino acid composition of whole-body protein and amino acid accretion rate in growing pigs.

An experiment was conducted to assess the effects of porcine somatotropin (pST) on the responses to a near-ideal blend of AA on the AA composition of empty, whole-empty body (WEB) protein and WEB essential AA accretion rate in pigs from 22 to 60kg BW. Forty Hampshire × Yorkshire gilts were individually penned and assigned to a 4 × 2 factorial arrangement of treatments consisting of four diets with and without pST injection. A fortified corn-soybean meal basal diet was formulated to contain 1.50% total Lys with Thr, Met, and Trp added to obtain a near-ideal blend of these AA relative to Lys. In three additional diets, Lys was reduced to 1.25%, 1.00%, and 0.75% by diluting the basal diet with cornstarch, cellulose, and sand such that the diets also contained the same ratios of AA. Pigs that received pST were administered a daily i.m. injection of 2mg of pST. At 60kg BW, the WEB (carcass, head, viscera, blood, nails, and hair) was ground and analyzed for proximate and AA composition. Administration of pST increased (P < 0.001) accretion rates of WEB protein and essential AA. Increasing dietary essential AA increased (quadratic, P < 0.03) accretion rate of WEB protein, His, Leu, Trp, and Val in pST-treated pigs, but not in untreated pigs. Lysine composition in the accreted WEB protein was not affected (P > 0.05) by dietary Lys. The efficiency of Lys utilization for WEB Lys accretion was linearly affected (P < 0.01) by dietary Lys. These results indicated that the dietary Lys needed to achieve maximum WEB Lys accretion is markedly increased by pST administration.

Redefining the bacteriophage mv4 site-specific recombination system and the sequence specificity of its attB and core-attP sites.

Through their involvement in the integration and excision of a large number of mobile genetic elements, such as phages and integrative and conjugative elements (ICEs), site-specific recombination systems based on heterobivalent tyrosine recombinases play a major role in genome dynamics and evolution. However, despite hundreds of these systems having been identified in genome databases, very few have been described in detail, with none from phages that infect Bacillota (formerly Firmicutes). In this study, we reanalyzed the recombination module of Lactobacillus delbrueckii subsp. bulgaricus phage mv4, previously considered atypical compared with classical systems. Our results reveal that mv4 integrase is a 369 aa protein with all the structural hallmarks of recombinases from the Tn916 family and that it cooperatively interacts with its recombination sites. Using randomized DNA libraries, NGS sequencing, and other molecular approaches, we show that the 21-bp core-attP and attB sites have structural similarities to classical systems only if considering the nucleotide degeneracy, with two 7-bp inverted regions corresponding to mv4Int core-binding sites surrounding a 7-bp strand-exchange region. We also examined the different compositional constraints in the core-binding regions, which define the sequence space of permissible recombination sites.

Immunogenicity and immunodominant linear B-cell epitopes of a new DNA-based tetravalent vaccine against four major enteroviruses causing hand, foot, and mouth disease

Hand, foot, and mouth disease (HFMD) poses a significant public health threat primarily caused by four major enteroviruses: enterovirus 71 (EV71), coxsackieviruses A16, A10, and A6. Broadly protective immune responses are essential for complete protection against these major enteroviruses. In this study, we designed a new tetravalent immunogen for HFMD, validated it in silico, in vivo evaluated the immunogenicity of the DNA-based tetravalent vaccine in mice, and identified immunogenic B-cell and T-cell epitopes. A new tetravalent immunogen, VP1me, was designed based on the chimeric protein and epitope-based vaccine principles. It contains a complete EV71 VP1 protein and six reported neutralizing B-cell epitopes derived from the four major enteroviruses causing HFMD. In silico validation using multiple immunoinformatic tools indicated good attributes of the VP1me immunogen suitable for vaccine development. The VP1me-based DNA vaccine efficiently induced both humoral and cellular immune responses in BALB/cAJcl mice. A combination of in silico prediction and immunoassays enabled the identification of immunogenic linear B-cell and CD8 T-cell epitopes within the VP1me immunogen. Immunodominant linear B-cell epitopes were identified in six regions of VP1me, with one epitope located at the N-terminus of the VP1 protein (aa 9–23) regarded as a novel epitope. Interestingly, some B-cell epitopes could also induce the CD8 T-cell response, suggesting their dual functions in immune stimulation. These results lay the groundwork for further development of VP1me as a new vaccine candidate.

Abstract 1900: TORL-3-600, a novel antibody drug conjugate directed against cadherin 17 (CDH17), has preclinical efficacy in colorectal, gastric, and pancreatic cancer

Abstract Cadherin 17 (CDH17) is a cell-to-cell adhesion protein that is a member of the cadherin superfamily. In normal tissues, expression of this single pass transmembrane protein is restricted to the lateral surfaces of intestinal and pancreatic ductal epithelial cells. However, in cancer, CDH17 is frequently overexpressed in tumors of the colon, stomach, and pancreas. The selective expression of this cell surface protein in these hard-to-treat cancer makes it an attractive target for the development of antibody-based therapeutics. Here, we describe the preclinical development of TORL-3-600, a novel CDH17-targeting antibody drug conjugate (ADC). CDH17 specific monoclonal antibodies were generated using traditional hybridoma technology and splenocytes isolated from mice immunized with cocktails of NIH3T3 cells overexpressing full length hCHD17 plus purified mammalian expressed hCDH17 extracellular domain protein (aa 23-787). Selective mAb binding was confirmed by flow cytometry and mAb internalization rate was assessed by immunofluorescence (IF). TORL-3-600 was generated from a fully humanized CDH17 mAb by MMAE conjugation with a cleavable linker. Cell membrane staining of CDH17 in patient tumor microarrays (TMAs), cell line (CDX) and patient derived xenografts (PDX) was evaluated by IHC assay. Selective binding of the TORL-3-600 to CDH17 was confirmed in human cancer cell lines and cells engineered to overexpress CDH17. Binding of TORL-3-600 to cell surface CDH17 induced Internalization and translocation to the lysosome of the protein-ADC complex for release of the MMAE payload. Treatment with TORL-3-600 induced significant regressions and tumor growth inhibition (TGI) in four CDH17-positive (CDH17+) human colorectal cancer (CRC) CDXs (103.6 - 140.4% TGI) and three CDH17+ CRC PDXs (63.3 - 102.2% TGI). Responses in these models were sustained for up to nine-weeks following cessation of treatment. Sustained inhibition of xenograft tumor progression was also observed in a cell line model of CDH17+ pancreatic cancer (85.8% TGI). In contrast, greatly reduced responses (37.3 - 58.2% TGI) to TORL-3-600 were observed in the CDH17- human colon cancer CDX and PDX models. Each of the doses tested in this study were well tolerated in mice with no dose-limiting toxicities observed. Analyses of large human patient TMAs by CDH17 IHC assay demonstrated detectable expression of CDH17 in 90.1% (173/193) of CRC, 51.8% (86/166) of gastric and 20.4% (69/331) of pancreatic cancers. These numbers suggest that an ADC directed against CDH17 could provide benefit to a significant number of patients diagnosed with these cancers. These data support the clinical development of TORL-3-600 for the treatment of CDH17+ cancers. TORL-3-600 has completed IND enabling toxicity studies with acceptable PK and toxicity profiles and is now in phase 1 clinical testing (NCT05948826). Citation Format: Neil A. O'Brien, Martina SJ McDermott, Jun Zhang, Ming Lu, Ke Wei Gong, Benjamin Hoffstrom, Wei Ping Jia, Tong Luo, Athena M. Madrid, Min Liang, John A. Glaspy, Dennis J. Slamon. TORL-3-600, a novel antibody drug conjugate directed against cadherin 17 (CDH17), has preclinical efficacy in colorectal, gastric, and pancreatic cancer [abstract]. In: Proceedings of the American Association for Cancer Research Annual Meeting 2024; Part 1 (Regular Abstracts); 2024 Apr 5-10; San Diego, CA. Philadelphia (PA): AACR; Cancer Res 2024;84(6_Suppl):Abstract nr 1900.

E3 SUMO ligase SIZ1 splicing variants localize and function according to external conditions.

SIZ1 (SAP and MIZ1) is a member of the Siz/PIAS-type RING family of E3 SUMO (small ubiquitin-related modifier) ligases that play key roles in growth, development, and stress responses in plant and animal systems. Nevertheless, splicing variants of SIZ1 have not yet been characterized. Here, we identified four splicing variants of Arabidopsis (Arabidopsis thaliana) SIZ1, which encode three different protein isoforms. The SIZ1 gene encodes an 873-amino acid (aa) protein. Among the four SIZ1 splicing variants (SSVs), SSV1 and SSV4 encode identical 885 aa proteins; SSV2 encodes an 832 aa protein; and SSV3 encodes an 884 aa protein. SSV2 mainly localized to the plasma membrane, whereas SIZ1, SSV1/SSV4, and SSV3 localized to the nucleus. Interestingly, SIZ1 and all SSVs exhibited similar E3 SUMO ligase activities and preferred SUMO1 and SUMO2 for their E3 ligase activity. Transcript levels of SSV2 were substantially increased by heat treatment, while those of SSV1, SSV3, and SSV4 transcripts were unaffected by various abiotic stresses. SSV2 directly interacted with and sumoylated cyclic nucleotide-gated ion channel 6 (CNGC6), a positive thermotolerance regulator, enhancing the stability of CNGC6. Notably, transgenic siz1-2 mutants expressing SSV2 exhibited greater heat stress tolerance than wild-type plants, whereas those expressing SIZ1 were sensitive to heat stress. Furthermore, transgenic cngc6 plants overaccumulating a mutated mCNGC6 protein (K347R, a mutation at the sumoylation site) were sensitive to heat stress, similar to the cngc6 mutants, while transgenic cngc6 plants overaccumulating CNGC6 exhibited restored heat tolerance. Together, we propose that alternative splicing is an important mechanism that regulates the function of SSVs during development or under adverse conditions, including heat stress.

Molecular and biological characterization of a novel partitivirus from Talaromyces pinophilus

Talaromyces spp. have a worldwide distribution, are ecologically diverse and have been isolated from numerous different substrates. Talaromyces spp. are considered biotechnologically important due to their ability to produce a range of enzymes and pigments. Talaromyces pinophilus, belonging to genus Talaromyces and family Trichocomaceae, is known for producing several important bioactive metabolites. Here we report the isolation and characterisation of a partitivirus from T. pinophilus which we have nominated Talaromyces pinophilus partitivirus-1 (TpPV-1). TpPV-1 possesses a genome consisting of three double stranded (ds) RNA segments i.e., dsRNAs1-3, 1824 bp, 1638 bp and 1451 bp respectively, which are encapsidated in icosahedral particles 35 nm in diameter. Both dsRNA1 and dsRNA2 contain a single open reading frame (ORF) encoding respectively a 572 amino acid (aa) protein of 65 kDa and a 504 aa protein of 50 kDa. The third segment (dsRNA3) is potentially a satellite RNA. Phylogenetic analysis revealed that the TpPV-1 belongs to the family Partitiviridae in the proposed genus Zetapartitivirus. TpPV-1 infection decreases the mycelial growth rate of the host fungus and alters pigmentation as indicated by time course experiments performed on a range of different solid media comparing virus-infected and virus-free isogenic lines. This is the first report of mycovirus infection in T. pinophilus and may provide insights into understanding the effect of the mycovirus on the production of enzymes and pigments by the host fungus.

First report of Moroccan watermelon mosaic virus in pumpkin plants in Brazil.

Cucurbita moschata is widely cultivated in Brazil, and zucchini lethal chlorosis virus, squash mosaic virus, papaya ringspot virus, watermelon mosaic virus have been reported as viral pathogens in this crop in Brazil. The leaf samples of C. moschata showing mosaic, blistering, and yellowing symptoms were collected from a commercial field in Petrolina, Pernambuco state and a commercial field in Juazeiro, Bahia state, in February 2023. To identify viruses that infect cucurbit plants in Brazil, three pooled samples showing virus-like symptoms (plants from the Cucurbita genus, the Cucumis genus, and other cucurbit plans including watermelon and chayote) were analyzed by high-throughput sequencing (HTS). The total RNA was extracted from the semi-purified virus using the protocol described by Blawid et al. 2017. The cDNA library was constructed from one RNA sample, which was composed of three pooled RNA samples (Cucurbita genus, the Cucumis genus, and other cucurbit plans), using TruSeq Stranded Total RNA with Ribo-Zero Plant kit (Illumina, San Diego, CA, US) and sequenced by HTS using Novaseq 10G scale (150 bp paired-ends). De novo assembly of total reads was performed using Megahit (Li et al. 2015), and the resulting contigs were analyzed using Blastx with RefSeq viral proteins 2023 (NCBI) in Geneious Prime (Biomatters, Auckland, New Zealand). Total of 88,028,898 reads were obtained and 407,500 contigs (mean length 514 nt) were assembled. Two contigs showed higher amino acid sequence identities (95.4% of 3124 aa in polyprotein and 87.2% of 203 aa in P1 protein) with Moroccan watermelon mosaic virus (MWMV) in the genus Potyvirus of the family Potyviridae (McKern et al. 1993), a virus that had not been previously reported in Brazil. The complete genome was assembled by the read mapping to the contigs as references. The assembled complete genome of MWMV (LC775353) was 9,713 nt, not counting the poly(A) tail, and 217,278 reads were aligned to the genome with a mean coverage of 3369.6 and a pairwise identity of 99.0%. The assembled genome encoded a polyprotein with a higher amino acid sequence identity of 97.82% with the Moroccan isolate (OQ847413). To confirm the presence of this virus in individual samples, RT-PCR was performed with specific primers (MWMV-F: ATTGTCTGATGAAAGAGCACA and MWMV-R: CAGCTTCAGTCGCAACAAG), targeting the cylindrical inclusion gene (the expected size of 598 bp). Eleven field samples of pumpkin plants (six from a field in Juazeiro region and five from Petrolina region) were analyzed using RT-PCR, and one sample from Juazeiro and five samples from Petrolina were positive for MWMV. One replicon of each region was sequenced (Juazeiro, OR338305; Petrolina, OR338306) and showed higher nucleotide identities of 97.0% with each other, and 96.4% and of 97.7%, respectively, with the isolate from Morocco (OQ847413). Samples positive for MWMV were tested for the presence of other viruses previously reported in Brazil. All five samples from Petrolina were positive by RT-PCR as a mixed infection with zucchini yellow mosaic virus (ZYMV) and cucurbit whitefly-borne yellows virus, also, four out of five samples were positive for papaya ringspot virus (PRSV). On the other hand, in one sample positive for MWMV from Bahia state, no mixed infection with ZYMV and PRSV was observed. This is the first report of the occurrence of MWMV in Brazil and South America, associated with mosaic, blistering and yellowing disease symptoms in pumpkin plants.

Nicotiana benthamiana Methanol-Inducible Gene (MIG) 21 Encodes a Nucleolus-Localized Protein That Stimulates Viral Intercellular Transport and Downregulates Nuclear Import.

The mechanical damage of plant tissues leads to the activation of methanol production and its release into the atmosphere. The gaseous methanol or vapors emitted by the damaged plant induce resistance in neighboring intact plants to bacterial pathogens but create favorable conditions for viral infection spread. Among the Nicotiana benthamiana methanol-inducible genes (MIGs), most are associated with plant defense and intercellular transport. Here, we characterize NbMIG21, which encodes a 209 aa protein (NbMIG21p) that does not share any homology with annotated proteins. NbMIG21p was demonstrated to contain a nucleolus localization signal (NoLS). Colocalization studies with fibrillarin and coilin, nucleolus and Cajal body marker proteins, revealed that NbMIG21p is distributed among these subnuclear structures. Our results show that recombinant NbMIG21 possesses DNA-binding properties. Similar to a gaseous methanol effect, an increased NbMIG21 expression leads to downregulation of the nuclear import of proteins with nuclear localization signals (NLSs), as was demonstrated with the GFP-NLS model protein. Moreover, upregulated NbMIG21 expression facilitates tobacco mosaic virus (TMV) intercellular transport and reproduction. We identified an NbMIG21 promoter (PrMIG21) and showed that it is methanol sensitive; thus, the induction of NbMIG21 mRNA accumulation occurs at the level of transcription. Our findings suggest that methanol-activated NbMIG21 might participate in creating favorable conditions for viral reproduction and spread.

CircNFIB decreases synthesis of arachidonic acid and inhibits breast tumor growth and metastasis

We identified circNFIB (hsa_circ_0086376) as a down-regulated circRNA in breast cancer but its effect is unclear. We aimed to explore the roles of circNFIB in breast cancer. The expression levels of circNFIB in breast cancer tissues and cells were detected. Both in vitro and in vivo experiments were used to assess the effects and mechanisms of circNFIB. circNFIB was down-regulated in 29 breast cancer tissues compared to adjacent normal tissues. circNFIB is a highly conserved circRNA and mainly located in cytoplasm of breast cancer cells. In vitro experiments showed that overexpression of circNFIB inhibited proliferation and invasion of breast cancer cells, whereas knockdown of circNFIB induced proliferation and invasion. Animal experiments indicated that circNFIB inhibited tumor growth and metastasis in vivo. Bioinformatics analysis showed that circNFIB contained an open reading frame (ORF) spanning its spliced junction, an internal ribosome entry site (IRES) and a N6-methyladenosine (m6A) site, suggesting circNFIB had the potential to encode a 56 amino acid (aa) protein, which was then confirmed by experiments. Metabonomics analysis results indicated that circNFIB may inhibit synthesis of arachidonic acid (AA) by regulating phospholipase. EIF4A3 and U2AF65 may regulate circNFIB expression by binding to the flanking sequence of circNFIB. In conclusion, circNFIB is a down-regulated circRNA in breast cancer tissues and encodes a 56 aa protein. circNFIB down-regulates AA in breast cancer cells, thus decreasing AA metabolites. Based on reported evidences of AA metabolites on cancer, we speculated that circNFIB may inhibit breast tumor growth and metastasis partly by inhibiting AA.

Association of Cd40 (rs1883832) SNP in some Iraqi patients with Rheumatoid Arthritis and their correlation with disease activity

Objective: To determine the genotyping of CD40 gene (rs1883832) single nucleotide polymorphism (SNP) amongrheumatoid arthritis patients, and to investigate its correlation with disease activity.Method: The case-control study was conducted at Baghdad Teaching Hospitals, its affiliated Rheumatology units andAl-Yarmouk Teaching Hospital, Baghdad, Iraq, from July 2020 to May 2021, and comprised adult females withrheumatoid arthritis in group A and healthy controls in group B. The disease activity in group A was evaluated usingthe Disease Activity Score in 28 Joints scale. Samples from both groups were genotyped using TaqMan Assay for clusterof differentiation gene rs1883832 single nucleotide polymorphism. Data was analysed using SPSS 28.Results: Of the 118 participants, 76(64.4%) were in group A with mean age 45.38±1.23 years, and 42(35.6%) were incontrol group B with mean age 46.48±2.02 years. At cluster of differentiation gene rs1883832 single nucleotidepolymorphism, there was a non-significant difference in the frequency of T and A alleles as well as in TT, AA and TA ingroup A patients compared to group B controls (p&gt;0.05). Rheumatoid factor and C-reactive protein concentrationswith TT, TA and AA genotypes in group A were significantly higher in group A compared to group B (p&lt;0.05). Withingroup A, there was a significant increase in the TT genotype and a significant decrease in the TA genotype in severecases compared to mild cases. (p&lt;0.05).Conclusion: The cluster of differentiation gene rs1883832 single nucleotide polymorphism T allele was found to be arisk factor for rheumatoid arthritis and disease severity. The TT and AA alleles acted as protective factors.Keywords: Polymorphism, Disease activity, Genotype.

Dengue virus serotype 2 genotype III evolution during the 2019 outbreak in Mato Grosso, Midwestern Brazil.

DENV-2 was the main responsible for a 70% increase in dengue incidence in Brazil during 2019. That year, our metagenomic study by Illumina NextSeq on serum samples from acute febrile patients (n=92) with suspected arbovirus infection, sampled in 22 cities of the state of Mato Grosso (MT), in the middle west of Brazil, revealed eight complete genomes and two near-complete sequences of DENV-2 genotype III, one Human parvovirus B19 genotype I (5,391nt) and one Coxsackievirus A6 lineage D (4,514nt). These DENV-2 sequences share the aminoacidic identities of BR4 lineage on E protein domains I, II and III, and were included in a clade with sequences of the same lineage circulating in the southeast of Brazil in the same year. Nevertheless, 11/34 non-synonymous mutations are unique to three strains inthis study, distributed in the E (n=6), NS3 (n=2) and NS5 (n=3) proteins. Other 14 aa changes on C (n=1), E (n=3), NS1 (n=2), NS2A (n=1) and NS5 (n=7) were first reported in a genotype III lineage, having been already reported only in other DENV-2 genotypes. All 10 sequences have mutations in the NS5 protein (14 different aa changes). Nine E protein aa changes found in two sequences, six of which are unique, are in the ectodomain; where the E:M272T change is on the hinge of the E protein at domain II, in a region critical for the anchoring to the host cell receptor. The NS5:G81R mutation, in the methyltransferase domain, was found in one strain of this study. Altogether, these data points to an important evolution of DENV-2 genotype III lineage BR4 during this outbreak in 2019 in MT. Genomic surveillance is essential to detect virus etiology and evolution, possibly related to immune evasion and viral fitness changes leading to future novel outbreaks.

Expression of Hsp70 in the red swamp crayfish, Procambarus clarkii in response to immune challenge

A heat shock protein 70 (Hsp70) was identified from Procambarus clarkii (named as PcHsp70). The open reading frame of the PcHsp70 cDNA was 1917 bp, encoding a 638 aa protein with signature sequences of the Hsp70 family. Tissue distribution results showed that PcHsp70 has relatively high expression in immune-related tissues such as hepatopancreas, gill, and hemocytes. The expressions of PcHsp70 in hepatopancreas and gill were significantly induced by Gram-positive bacterium, Gram-negative bacterium, and white spot syndrome virus stimulation, indicating that PcHsp70 may be involved in the immune response to pathogen invasion. The research will provide a foundation for understanding the resistance and stress mechanism of Hsp70 in P. clarkii.

Fibroblast Growth Factor 11 Inhibits Hepatitis B Virus Gene Expression Through FXRα Suppression

Fibroblast growth factor 11 (FGF11) is a member of the intracellular FGF family, which shows different signal transmission compared with other FGF superfamily members. The molecular function of FGF11 is not clearly understood. In this study, we identified the inhibitory effect of FGF11 on hepatitis B virus (HBV) gene expression through transcriptional suppression. FGF11 decreased the mRNA and protein expression of HBV genes in liver cells. While the nuclear receptor FXRα1 increased HBV promoter transactivation, FGF11 decreased the FXRα-mediated gene induction of the HBV promoter by the FXRα agonist. Reduced endogenous levels of FXRα by siRNA and the dominant negative mutant protein (aa 1–187 without ligand binding domain) of FXRα expression indicated that HBV gene suppression by FGF11 is dependent on FXRα inhibition. In addition, FGF11 interacts with FXRα protein and reduces FXRα protein stability. These results indicate that FGF11 inhibits HBV replicative expression through the liver cell-specific transcription factor, FXRα, and suppresses HBV promoter activity. Our findings may contribute to the establishment of better regimens for the treatment of chronic HBV infections by including FGF11 to alter the bile acid mediated FXR pathway.

Amyloid goiter secondary to familial Mediterranean fever with E148Q mutation: A unique case.

Amyloid goiter secondary to familial Mediterranean fever with E148Q mutation: A unique case.

#4547 IDENTIFICATION OF GLYCOSYLATED IGF2 IN HUMAN URINARY PEPTIDOME AND ITS ASSOCIATION WITH CKD

Abstract Background and Aims Chronic kidney disease (CKD) is prevalent in 10% of world's adult population, with estimated glomerular filtration rate (eGFR) and albuminuria employed in its diagnosis. Role of protein glycosylation in causal mechanisms of CKD progression is largely unknown. Aim of this study was to identify urinary O-linked glycopeptides in association to CKD for better characterization of CKD molecular manifestations. Method Urine samples from eight CKD and two healthy subjects were analyzed by Capillary Electrophoresis-Tandem Mass Spectroscopy (CE-MS/MS) and glycopeptide analysis using Proteome Discoverer 1.4 was performed. Distribution of identified glycopeptides and correlation with Age, eGFR and Albuminuria were evaluated in 3810 datasets from the Human Urinary Proteome database using Spearman's rank correlation test and multiple linear regression analysis by statistical software R. The quantification of Insulin-like growth factor-II (IGF2) protein (7.5 kDa) was performed by enzyme-linked immunosorbent assay (ELISA) in two matched (for age, sex, no diabetes and no cardiovascular history) groups of 12 plasma samples each (eGFR &amp;lt; 30 ml/min/1.73m2 and eGFR &amp;gt; 90 ml/min/1.73m2). An open-source tool “Proteasix” was used to predict proteases involved in cleavage of the identified glycopeptides. The transcriptomics database and analysis tool “Nephroseq v4” were utilized to investigate the expression of predicted proteases in existing human transcriptomics CKD datasets. Results In total, 17 O-linked glycopeptides from 7 different proteins were identified, derived primarily from Insulin-like growth factor-II (IGF2) (n = 6). Glycosylation occurred at the surface exposed IGF2 Threonine 96 position. Further Investigation of the human proteome database containing 3810 datasets, showed that only three unglycosylated urinary peptides of IGF2 were identified, at significantly lower abundance and frequency (0-2.5% in the database) in comparison to the glycosylated forms (frequency of 23-90%). Interestingly, all identified IGF2 peptides belonged to E-domain of IGF2, i.e., 92 – 180 aa; which cleaves after undergoing O-linked glycosylation during the post-translational process yielding the “mature IGF2” (25-91 aa) protein. Results of multiple linear regression analysisa indicated that three IGF2 glycopeptides, DVStPPTVLPDNFPRYPVGKF [β(1024) = 0.08, p = 1.42*10−4], DVStPPTVLPDNFPRYPVG [β(560) = 0.01, p = 5.22*10−5] and DVStPPTVLPDNFPRYP [β(290) = 0.02, p = 1.07*10−4], exhibited positive correlation with Age and the glycopeptide tPPTVLPDNFPRYP showed strong negative association with eGFR [β(177) = -0.01, p = 4.21*10−9]. Along the same lines, the latter urinary IGF2 glycopeptide tPPTVLPDNFPRYP was found at increased [p &amp;lt; 2.2*10−16] abundance in CKD (n = 686) in comparison to healthy control (n = 229) datasets. In addition, IGF2 increased [p = 0.042] plasma levels were observed in CKD patients (eGFR &amp;lt; 30 ml/min/1.73m2 group) as supported by ELISA measurements. Protease predictions, considering also available transcriptomics data, suggest activation of cathepsin S with CKD potentially involved in the cleavage of the CKD-associated glycopeptide of IGF2. Conclusion Collectively, this study indicates that with aging and deteriorating kidney function, alterations in IGF2 proteoforms take place; which may be reflective of respective changes in the mature IGF2 protein abundance and function; as well as associated protease activity. Further, correlation analyses of the levels of the CKD-associated urinary IGF2 glycopeptide with the plasma IGF2 levels with CKD progression is planned. a Results of multiple linear regression where regression Co-efficient is β; degree of freedom is stated in (brackets); and p-value &amp;lt;0.05 was considered statistically significant

Eucalcemia during lipopolysaccharide challenge in postpartum dairy cows: I. Clinical, inflammatory, and metabolic response

Hypocalcemia induced by immune activation is a conserved response across mammalian species; however, administration of Ca is discouraged in other species as it is associated with increased morbidity and mortality. Early postpartum cows experience a decrease in circulating Ca concentration following acute inflammation. Corrective Ca therapy during the transition period, particularly in dairy cows experiencing acute disease, is common practice. However, the effect of Ca administration on the inflammatory response during acute immune activation is unknown. Our objective was to compare the clinical, inflammatory, and metabolic response to an intravenous (IV) lipopolysaccharide (LPS) challenge between postpartum cows infused, or not, with IV Ca to maintain eucalcemia. Cows (n = 14, 8 ± 1 d in milk) were enrolled in a matched-pair randomized controlled design to receive IV Ca (IVCa) or sterile 0.9% NaCl (CTRL) during an IV LPS challenge (0.040 or 0.045 µg of LPS/kg of body weight over 1 h). Ionized Ca (iCa) was monitored cow-side, and IV Ca infusion was adjusted in a eucalcemic clamp for 12 h following the start of LPS infusion. Cows were monitored during the 24 h following challenge and serial blood samples were collected to quantify concentrations of glucose, β-hydroxybutyrate, nonesterified fatty acids, urea nitrogen, cytokines, acute-phase proteins, and cortisol. Blood iCa concentration decreased to 0.87 ± 0.03 mM in CTRL during challenge, and by design, iCa concentration was maintained within 3% of baseline in IVCa. Body temperature, heart rate, and respiratory rate were monitored for 24 h following the start of challenge and did not differ between groups. A treatment × time interaction was identified such that serum cortisol concentrations increased in both groups at 2 h but decreased to a greater extent at 6 h in IVCa compared with CTRL. Rumination time (min/h) over the first 12 h following challenge was greater in IVCa, but total rumination time in the 24 h following challenge did not differ from CTRL. Serum glucose and nonesterified fatty acid concentrations decreased, and β-hydroxybutyrate and urea nitrogen concentrations increased over time, but did not differ between groups. Acute leukopenia occurred in both groups at 4 h before leukocytosis was observed at 24 h with total white blood cell counts returning to baseline within 72 h. Plasma concentrations of tumor necrosis factor (TNF) and interleukin-10 (IL-10) increased within 1 h following the start of challenge and did not differ between groups. Serum haptoglobin and serum amyloid A concentrations increased within the 24 h following challenge and were elevated through 72 h but did not differ between groups. Eucalcemia during the acute systemic inflammatory response did not alter the TNF or IL-10 cytokine response, or the acute-phase protein SAA and haptoglobin response in this LPS challenge model; however, eucalcemia was associated with a more rapid decline in cortisol response and greater rumination time in the first 12 h following challenge. We did not find evidence that eucalcemia exacerbated the inflammatory response in early postpartum cows, but Ca administration may alter the clinical response to acute systemic inflammation.