Aa Identity Research Articles

A taxonomic note on the order Caryophanales: description of 12 novel families and emended description of 21 families

The order Caryophanales, belonging to class Bacilli, is globally distributed in various ecosystems. Currently, this order comprised 12 families that show vast phenotypic, ecological and genotypic variation. The classification of Caryophanales at the family level is currently mainly based on 16S rRNA gene sequencing analysis and the presence of shared phenotypic characteristics, resulting in noticeable anomalies. Our present study revises the taxonomy of Caryophanales based on 1080 available high-quality genome sequences of type strains. The evaluated parameters included the core-genome phylogeny, pairwise average aa identity, lineage-specific core genes, physiological criteria and ecological parameters. Based on the results of this polyphasic approach, we propose that the order Caryophanales be reclassified into 41 families, which include the existing 12 families, 17 families in a recent Validation List in the IJSEM (Validation List no. 215) and 12 novel families for which we propose the names Aureibacillaceae, Cytobacillaceae, Domibacillaceae, Falsibacillaceae, Heyndrickxiaceae, Lottiidibacillaceae, Oxalophagaceae, Pradoshiaceae, Rossellomoreaceae, Schinkiaceae, Sulfoacidibacillaceae and Sutcliffiellaceae. This work represents a genomic sequence-based and systematic framework for classifying the order Caryophanales at the family level, providing new insights into its evolution.

First report of lily mottle virus naturally infecting lily (Lilium asiatica) in Texas, USA.

Lily (Lilium asiatica) is an important plant grown for its range of flower colors and heavy scent. In March 2024, potyvirus-like symptoms consisting of light-yellow mottling and mosaic were noticed on 12/20 lily plants in a private property in Weslaco, Hidalgo County, Texas. Two symptomatic plants (WTX1 and WTX2) were sampled randomly for virus diagnosis. The leaf extracts of both samples were negative for the potyvirus group using Agdia's Poty ImmunoStrip® (Agdia, Inc., Elkhart, IN, USA). However, rub-inoculation of the extracts onto healthy Nicotiana benthamiana and Vigna unguiculata plants (n=4, each) induced mild mottle symptoms on the systemic leaves of both herbaceous test plants 20 to 28 days post inoculation, indicating the presence of a mechanically transmissible agent in the samples. No virus-like symptoms were observed on the mock-inoculated plants (n=1, each) of both species. To test for suspected potyvirus infection, 2-µg of total nucleic acid extracts (Dellaporta et al. 1983) from WTX1 and WTX2 were used for complimentary DNA (cDNA) synthesis with Oligo(dT) primer and the PrimeScript 1st strand cDNA synthesis kit (Takara Bio, USA). One microliter aliquot of each cDNA served as template in 12.5-µl conventional PCR reaction volumes with 5 U Taq polymerase (Roche Diagnostics, Indianapolis, IN), and two pairs of degenerate primers targeting the partial cylindrical inclusion (CI) gene and the helper component protease (HC-Pro) of potyviruses (Ha et al. 2008). The expected ~700-bp DNA product of each gene target was amplified from both samples. The amplicons were excised, gel eluted (Zymoclean™ Gel DNA Recovery kit) and cloned individually into the pJET1.2/Blunt vector (Life Technologies). Recombinant plasmids from two transformed Escherichia coli cells per cloned DNA insert were Sanger sequenced. BLASTn analysis of each gene-specific nucleotide (nt) sequence fragment revealed their identities (83 to 92 % nt) as lily mottle virus (LMoV; genus Potyvirus) at 93 to 98% query coverage. In pairwise comparison, the obtained sequences of LMoV isolates from TX specific to the CI (GenBank accession nos. PQ037260-61) and the HC-Pro (PQ037262-63) shared ~99% nt and 100% amino acid (aa) identities with each other and ~91-92% nt and 98-100% aa identities with the closest isolate, Bate5 (JN127341) from Australia. Based on these results, a pair of LMoV-specific primers (LM_v109-F: 5'-GGCCAGTAATGTGCACAAGC-3' and LM_c527-R: 5'-TCGCTGTAGCTAGCGACGTAC-3') was newly designed to target the partial CI gene, internal to the 700-bp fragment obtained above with the generic primers. The primer pair was used to screen each of the mechanically inoculated test plants by RT-PCR as previously described above. The expected 438-bp fragment of the LMoV CI gene was amplified from all the inoculated plants of both N. benthamiana and V. unguiculata; the results were confirmed by Sanger sequencing as described above. The mock-inoculated plant of each experimental host plant tested negative for LMoV. LMoV is a quarantine pest and was previously reported in the U.S. (Brierley and Smith, 1944) and other lily-producing parts of the world, such as the Netherlands, China, Korea, and Brazil. To our knowledge, this is the first confirmed report of the virus in Texas, thus expanding its geographical range. Testing of lily foundation stocks before propagation is essential to prevent further spread of LMoV via planting material.

First Report of Beet Western Yellows Virus Infecting Vasconcellea x heilbornii (Caricaceae) in Ecuador.

Vasconcellea x heilbornii, known as babaco, is a hybrid native to Ecuador grown in small orchards in sub-tropical highland regions. Over the last decade, several viruses have been identified in babaco using high-throughput sequencing (HTS) (Cornejo-Franco et al. 2020, (Reyes-Proaño et al. 2023). In 2021, total RNA from a babaco plant showing distinctive leaf yellowing was extracted using the PureLink RNA Mini Kit (Thermo Fischer Scientific, USA) and subjected to HTS on an Illumina NovaSeq6000 system as 150 paired-end reads (Macrogen Inc., South Korea). Library construction was done using the TruSeq Stranded Total RNA Sample kit with Plant Ribo-Zero, as described (Villamor et al. 2022). Reads were processed using BBDuk and de novo assembled using SPAdes 3.15. both implemented in Geneious 2022. Contig analysis was done by BLASTx using the NCBI viral sequence database (as of November 2022). HTS generated 54 million reads, of which 12% assembled into contigs corresponding to genomes of previously reported babaco viruses including babaco virus Q (BabVQ), babaco nucleorhabdovirus 1 (BabRV1) and babaco ilarvirus 1 (BabIV1). Interestingly, 144 reads (0.0003%) assembled into seven contigs ranging from 100 to 480 nucleotides (nt) in length. These contigs showed homology, with 97% amino acid (aa) identity (100% query coverage), to regions of the RNA-dependent-RNA-polymerase (RdRp) of beet western yellows virus (BWYV, Acc. No. NC_004756), a member of the Polerovirus genus. To confirm the occurrence of BWYV in babaco, double-stranded RNA (dsRNA) was extracted from 15 g of leaf tissue from the original sample as described (Dodds et al. 1984) and used as template for reverse-transcription (RT)-PCR using overlapping primers designed to span all short contigs. RT-PCR amplified fragments were cloned into a pGEM®T-easy vector (Promega, USA) and sequenced by the Sanger method (Macrogen Inc., South Korea). The sequences were assembled into a single 2.7 kbp BWYV genome fragment comprising the complete protein 1 (P1) and partial RdRp gene (GenBank Acc. No. PP480670). Sequence alignments between the partially sequenced genome of the babaco isolate and its corresponding fragment from the closest BWYV isolate (NC_004756) revealed 94% and 97% identities at the nt and aa levels, respectively. To assess the prevalence of BWYV in babaco, 30 leaf samples showing yellowing symptoms from Pichincha (n=15) and Azuay (n=15) provinces were tested by RT-PCR using total RNA. Total RNA extraction and reverse transcription were done using the methodology described by Halgren et al. (2007). For RT-PCR, the primer set BWYV_Bab_F: 5'-CAGTGTCCTCCAAGTGCAACAT-3' / BWYV_Bab_R: 5'GGTTCCTTCCCAGTTTGGTGGT-3', which amplifies a 235 nt-long P1 region, was used. Three RT-PCR products from each positive sample were purified using the GeneJET PCR clean-up kit (Thermo Scientific, USA) and sequenced. BWYV was confirmed in 9 out of 15 samples (60%) from Pichincha, and in 10 out of 15 samples (64%) from Azuay. Samples were also tested for additional babaco viruses as described (Reyes-Proaño et al. 2023). All BWYV-infected plants turned out positive for papaya ringspot virus (PRSV), babaco mosaic virus (BabMV), BabVQ, and BabIV1. Hence, the impact of BWYV infection on babaco plants in single and mixed infections warrants further investigation. To the best of our knowledge, this is the first report of BWYV in a crop in Ecuador, and the first time it has been found in a Caricaceae species.

First Report on Detection and Molecular Characterization of Astroviruses in Mongooses.

Applying a pan-astrovirus (AstV) RT-hemi-nested PCR assay, we report here high detection rates (28.3%, 15/53) of AstVs in the small Indian mongoose (Urva auropunctata) on the Caribbean Island of St. Kitts. Based on deduced amino acid (aa) identities and phylogenetic analysis of long RNA-dependent RNA polymerase (RdRp) sequences (~315 aa, partial RdRp), the AstVs detected in the mongooses (designated as Mon-AstVs) were classified into two distinct groups (deduced aa identities of 66.45-67.30% between the groups). The putative RdRps of the Mon-AstVs shared low deduced aa identities with those of AstVs from other host species (<69%, <54%, and <50% identities with reptilian/amphibian AstVs, avastroviruses, and mamastroviruses, respectively). Phylogenetically, the group-I and group-II Mon-AstVs formed two distinct clusters, near the cluster of reptilian/amphibian AstVs, and were distantly related to avastroviruses and mamastroviruses. Since the mongooses were apparently healthy during sampling, we could not establish if the Mon-AstVs infected the animal or were of dietary origin. Although we could not ascertain the true host of the Mon-AstVs, phylogenetic analysis indicated that these viruses might have originated from lower vertebrates. To our knowledge, this is the first report on the detection and molecular characterization of AstVs in mongooses, highlighting the wide host range and significant genetic diversity within the family Astroviridae.

Considerations for working with Asian Americans across the psychosis spectrum following the onset of the COVID-19 pandemic.

With the rise of anti-Asian racism and discrimination that followed the onset of the COVID-19 pandemic, the need to improve Asian Americans' (AA) connection to and experiences with clinical care is critical. AA at risk for or experiencing psychosis represent a particularly vulnerable subset of a population that already exhibits low service utilization and a multitude of barriers to mental health care treatment. Considering that victimization and discrimination were well-documented factors that exacerbate psychotic symptoms prepandemic, preparing clinicians to adequately support this already hard-to-reach population warrants special attention. In this article, we argue for the importance of addressing the unique needs of this population in an acute time of need. We outline three main considerations for working with AA across the psychosis spectrum, including actionable steps clinicians can implement related to (a) the variability in AA identities, (b) the relationship between victimization and psychosis, and (c) improving access to culturally sensitive mental health care treatment. By considering the diverse needs of AA at risk for or living with psychosis, clinicians across professional levels and contexts can better serve this vulnerable population. (PsycInfo Database Record (c) 2024 APA, all rights reserved).

Updates on hosts and distribution of pepper yellow leaf curl Indonesia virus and squash leaf curl China virus in Central Java Province, Indonesia

Chili pepper, tomato, and squash cultivated in Magelang Regency, Central Java Province, Indonesia showed severe viral symptoms. Three samples were taken then molecularly tested against begomovirus, potyvirus, tobamovirus, and polerovirus. However, PCR test confirmed only begomovirus infections. BLAST analysis concluded that the chili pepper and tomato isolates were pepper yellow leaf curl Indonesia virus (PepYLCIV) while the squash isolate was squash leaf curl China virus (SLCCNV). The 552 bp partial AV1 gene sequences of the three isolates were given NCBI GenBank acc nos. OR924278-80. PepYLCIV OR924279 and OR924280 formed a subgroup with LC542629 from Bali in the phylogenetic tree constructed using MEGA11, and shared 95.8 – 96.7% identities at nucleotide (nt) and 98.4 – 99.5% at amino acid (aa) levels according to Sequence Demarcation Tool v1.2 software. Meanwhile, SLCCNV OR924278 was clustered, and shared 95.8 – 96.7% nt and 98.4 – 99.5% aa identities with three Malaysian isolates (MW248685, MW248687, and MW248689). Different plant species inoculated with SLCCNV OR924278 remained symptomless up to four weeks observation, suggesting that the isolate is not mechanically transmissible. This study contributed additional knowledge on molecular variation while expanding hosts and distribution of PepYLCIV and SLCCNV in Central Java Province.

Molecular detection of ovine gammaherpesvirus 2 in free ranging wild boars (Sus scrofa) from Southern Brazil.

Ovine gammaherpesvirus 2 (OvGHV2) is a member of Macavirus genus, subfamily Gammaherpesvirinae, family Herpesviridae, and causes sheep associated-malignant catarrhal fever (SA-MCF) in a wide range of ungulates. However, no descriptions of SA-MCF and/or infections due to OvGHV2 were identified in the wild boar (Sus scrofa). This study investigated the occurrence of OvGHV2 in the lungs (n = 44) of asymptomatic, free ranging wild boars captured in several regions of Paraná State, Southern Brazil. A PCR assay targeting the OvGHV2 tegument protein gene amplified OvGHV2 DNA in 4.55% (2/44) of the pulmonary tissues evaluated. Sequence analysis confirmed that the OvGHV2 strains herein identified have 98.4% deducedamino acid (aa) sequence identity with the prototype strain of OvGHV2 and 96.4-100% aa identity with similar strains of OvGHV2 detected in several animal species from diverse countries. These findings confirmed that these two wild boars were infected by OvGHV2, represent the first description of this infection in these animals, and add to the number of pathogens identified in this animal species. Furthermore, these findings contrast earlier descriptions of OvGHV2 in swine since in all previous reports the infected pigs demonstrated clinical manifestations of disease. Consequently, these wild boars from Southern Brazil were subclinically infected or suffered asymptomatic infections by OvGHV2.

Genetic characterization and molecular epidemiological analysis of enterovirus C99 in China.

Enterovirus C99 (EV-C99) is a newly identified EV serotype within the species Enterovirus C. Few studies on EV-C99 have been conducted globally. More information and research on EV-C99 are needed to assess its genetic characteristics, phylogenetic relationships, and associations with enteroviral diseases. Here, the phylogenetic characteristics of 11 Chinese EV-C99 strains have been reported. The full-length genomic sequences of these 11 strains show 79.4-80.5% nucleotide identity and 91.7-94.3% amino acid (aa) identity with the prototype EV-C99. A maximum likelihood phylogenetic tree constructed based on the entire VP1 coding region identified 13 genotypes (A-M), revealing a high degree of variation among the EV-C99 strains. Phylogeographic analysis showed that the Xinjiang Uygur Autonomous Region is an important source of EV-C99 epidemics in various regions of China. Recombination analysis revealed inter-serotype recombination events of 16 Chinese EV-C99 strains in 5' untranslated regions and 3D regions, resulting in the formation of a single recombination form. Additionally, the Chinese strain of genotype J showed rich aa diversity in the P1 region, indicating that the genotype J of EV-C99 is still going through variable dynamic changes. This study contributes to the global understanding of the EV-C99 genome sequence and holds substantial implications for the surveillance of EV-C99.

Identification and characterization of a novel Cytorhabdovirus associated with goji berry (Lycium barbarum L.) crinkle disease.

Goji berry (Lycium barbarum L.) is a traditional Chinese herbal medicinal plant that is extensively cultivated in the arid and semiarid regions of northwest China. In this study, a novel cytorhabdovirus, tentatively named "goji cytorhabdovirus A (GCVA)," was identified from the goji berry plant exhibiting leaf crinkle symptoms through high-throughput sequencing (HTS). GCVA contains a linear, negative sense single-stranded RNA genome of 14,812 nucleotides and encodes six open reading frames in the order of 3' leader-N-P-P4-M-G-L-5' trailer. The genome of GCVA shares the highest nucleotide (nt) identity of 65.80% (16% query coverage) with yerba mate virus A (YmVA) (NC_076472). The N and L proteins also share low amino acid (aa) identities (<35.42 and < 41.23%, respectively) with known cytorhabdoviruses. Typical features of the viruses in the genus Cytorhabdovirus include a highly conserved consensus sequence in the intergenic regions and extensive complementation of the 5' non-coding trailer and the 3' leader. These features were also found in GCVA. These data in combination with a phylogenetic analysis that was based on the aa sequences of the N and L proteins support the proposal that GCVA is a new species in the genus Cytorhabdovirus.

Clonal Trafficking of Individual T Cells between Peripheral Blood and Inflamed Synovial Tissue in Patients with Immune-Mediated Refractory Arthritis

Background Rheumatoid arthritis (RA) is the most prevalent form of immune mediated arthritis, which is characterised by immune-mediated destruction of synovial joints, leading to synovitis, acute joint pain, reduced motility, and mortality. Enrichment of CD4+ memory T cell subsets with local clonal expansions in the RA synovial tissue (ST) has been extensively reported in the literature. In addition, emerging evidence suggests that CD8+ T cells with inflammatory phenotypes are also present in increased numbers in the ST. However, little is known about whether these populations represent autoantigen-experienced migratory T cells or locally proliferated populations. Here, with the help of paired single cell T cell receptor (scTCR) and RNA sequencing recognizing individual T cell clones, we aimed to gain insights into the trafficking of T cells between peripheral blood (PB) and inflamed target tissue. Methods We collected ST and PB samples from patients with immune mediated arthritis during surgical synovectomy. The patients had been diagnosed with seronegative juvenile arthritis (Pt1-JIA), seropositive RA (Pt2-SP) and seronegative RA (Pt3-SN), and at the time of sampling they were refractory to treatment. We flow sorted T cells and CD45+ leukocytes from ST and PB and profiled them with 10x Genomics 5´-scRNA+V(D)J-seq. Altogether, we captured 68,610 cells passing quality control thresholds. We integrated the data from all individual samples using scVI and visualised the subpopulation structure using UMAP dimensionality reduction as implemented in the Seurat package. Results Altogether we analysed 34134 CD4+ T cells and 23385 CD8+ T cells from PB and ST. In concordance with previous reports, we observed strong transcriptomic differences between the tissue of origin for both CD4+ and CD8+ T cells. We pooled all CD4+ and CD8+ T cells separately and further grouped all cells with identical CDR3b aa sequences into unique clones. In CD8+ T cells, a high number of clones (n=101, pertaining to 7409 cells) was shared between PB and ST. 8 of these clones were enriched to the ST as compared to PB. Interestingly, Pt2-SP harboured a large clone in the ST consisting of 27% of the CD8+ T cells (CDR3b sequence - CASRGGTSITDTQYF). This clone was also detected in PB with a much smaller frequency of only 2% and in a phenotypically different cluster, indicating local proliferation of specific T cell clones in the synovium. By performing a DE gene analysis between cells with the same TCR but between different tissues of origin, we found that the top upregulated genes in ST were CCL4 and CREM suggesting more activated and inflamed phenotype in ST. In the CD4+ compartment, we found only 12 intersecting TCR clones pertaining to 637 cells. Majority of these clones were coming from PB (458 cells from PB and 179 from ST) and were hyperexpanded in PB as compared to ST. No matches for common viral or bacterial epitopes in the existing VDJ database for any of the intersecting clones was found. We then pooled all T cell clones that were enriched in the ST and found 113 clones (p &amp;lt; 0.05, Fisher's exact test). DE gene analysis showed that ST enriched clones have a more activated profile. Pathway enrichment analysis with hypergeometric testing against the GO Biological Process database identified T cell activation and positive regulation of cell adhesion as the top hits. Using GLIPH2, we used publicly available data from a cohort of JIA patients to check TCR level similarity between the two cohorts. We found common motifs between these two cohorts in some of the hyperexpanded clones from PB and ST, and interestingly, TCRs which were predicted to target similar antigens, were enriched to both expanded and intersecting clones. By performing DE gene analysis, we found that predicted TCRs with similarity were more cytotoxic ( GZMH, GNLY, NKG7, GZMB, GZMA) and they overexpressed the TRBV7-6 gene. Conclusions Our results suggest that the cytokine signalling environment in the ST leads to a widespread activation and inflammatory signature within the T cell compartment. This shift in the phenotype occurs within clonal families and is not due to the selective recruitment of activated cells to inflamed tissue. Additional investigations may elucidate the cellular interactions that promote expansion of specific disease promoting clones in ST and provide a more detailed understanding of the spatiotemporal aspects of this process.

First report of cereal yellow dwarf virus RPS infecting wheat in Australia.

Yellow dwarf viruses (YDVs) reduce grain yield in a wide range of cereal hosts worldwide. Cereal yellow dwarf virus RPV (CYDV RPV) and cereal yellow dwarf virus RPS (CYDV RPS) are members of the Polerovirus genus within the Solemoviridae family (Scheets et al. 2020; Sõmera et al. 2021). Along with barley yellow dwarf virus PAV (BYDV PAV) and barley yellow dwarf virus MAV (BYDV MAV) (genus Luteovirus, family Tombusviridae), CYDV RPV is found worldwide and has mostly been identified as being present in Australia based on serological detection (Waterhouse and Helms 1985; Sward and Lister 1988). However, CYDV RPS has not previously been reported in Australia. In October 2020, a plant sample (226W) was collected from a volunteer wheat (Triticum aestivum) plant located near Douglas, Victoria, Australia that displayed yellow-reddish leaf symptoms typical of YDV infection. The sample tested positive for CYDV RPV and negative for BYDV PAV and BYDV MAV by tissue blot immunoassay (TBIA) (Trębicki et al. 2017). Given that CYDV RPV and CYDV RPS can both be detected using serological tests for CYDV RPV (Miller et al. 2002), total RNA was extracted from stored leaf tissue of plant sample 226W for further testing using the RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) with modified lysis buffer (Constable et al. 2007; MacKenzie et al. 1997). The sample was then tested by RT-PCR using three sets of primers that were designed to detect CYDV RPS, targeting three distinct overlapping regions (each approximately 750 bp in length) of the 5' end of the genome where CYDV RPV and CYDV RPS differ most (Miller et al. 2002). The primers CYDV RPS1L (GAGGAATCCAGATTCGCAGCTT)/ CYDV RPS1R (GCGTACCAAAAGTCCACCTCAA) targeted the P0 gene, while CYDV RPS2L (TTCGAACTGCGCGTATTGTTTG)/ CYDV RPS2R (TACTTGGGAGAGGTTAGTCCGG) and CYDV RPS3L (GGTAAGACTCTGCTTGGCGTAC)/ CYDV RPS3R (TGAGGGGAGAGTTTTCCAACCT) targeted two different regions of the RdRp gene. Sample 226W tested positive using all three sets of primers and the amplicons were directly sequenced. NCBI BLASTn and BLASTx analyses showed that the CYDV RPS1 amplicon (Accession No. OQ417707) shared 97% nucleotide (nt) identity and 98% amino acid (aa) identity similarity with the CYDV RPS isolate SW (Accession No. LC589964) from South Korea, while the CYDV RPS2 amplicon (Accession No. OQ417708) shared 96% nt identity and 98% aa identity similarity with the same CYDV RPS isolate SW. The CYDV RPS3 amplicon (Accession No. OQ417709) shared 96% nt identity and 97% aa identity similarity with the CYDV RPS isolate Olustvere1-O (Accession No. MK012664) from Estonia, confirming that isolate 226W is CYDV RPS. In addition, total RNA extracted from 13 plant samples that had previously tested positive for CYDV RPV by TBIA were tested for CYDV RPS using the primers CYDV RPS1 L/R and CYDV RPS3 L/R. The additional samples, consisting of wheat (n=8), wild oat (Avena fatua, n=3) and brome grass (Bromus sp., n=2), were collected at the same time as sample 226W from seven fields within the same region. Five of the wheat samples were collected from the same field as sample 226W, one of which tested positive for CYDV RPS while the remaining 12 samples were negative. To the best of our knowledge, this is the first report of CYDV RPS in Australia. It is not known if CYDV RPS is a recent introduction to Australia, and its incidence and distribution in cereals and grasses in Australia, while currently unknown, is being investigated.

First report of Fig virus B in Ficus carica in New Zealand.

Fig (Ficus carica) has been cultivated since ancient times, and is now grown worldwide, both for its fruit and as an ornamental plant. Several viruses and viroids are associated with Fig mosaic disease (FMD), a disease complex occurring worldwide (Preising et al. 2021). Fig mosaic virus (FMV), fig leaf mottle-associated virus 1 (FLMaV-1), fig mild mottle-associated virus (FMMaV), and fig badnavirus 1 (FBV-1) are known to infect fig in New Zealand (Minafra et al. 2012; Veerakone et al. 2015). In December 2020, leaf samples from a fig tree growing on the roadside at St Heliers, Auckland, showing dieback with foliar chlorotic mosaic symptoms, was received for virus testing. Total nucleic acid was extracted from the symptomatic leaves using a KingFisher™ mL Purification System (Thermofisher Scientific, Waltham, MA) with an InviMag Plant DNA Mini Kit (Invitek Molecular GmbH, Germany) and subjected to high-throughput sequencing on an Oxford Nanopore Technologies MinION device using the method described in Liefting et al. 2021. All sequence analysis was performed using Geneious Prime 2021.1.1 (https://www.geneious.com). A total of 355,858 reads that passed quality check were subjected to BLASTn search against the NCBI nt database as described in Liefting et al. 2021. The following viruses produced hits: FMV, FBV-1, FMMaV and a fig closterovirus. The presence of FMV, FBV-1 and FMMaV were confirmed by species specific RT-PCRs. To identify the closterovirus, reads were mapped to closteroviruses reported in fig including the recently identified tentative species fig virus A (FiVA; GenBank accession no MN817232) and fig virus B (FiVB; GenBank accession no. MN817233). Five viral contigs ranging from 939 to 2,340 nucleotides (nt) were obtained from mapping to FiVB. Subsequently, a 6.4 kb sequence (GenBank accession no. OQ968551) from the 3' region of the NZ isolate was amplified by overlapping RT-PCR using primers designed from the contig sequences. The sequence shared 79.5% nucleotide (nt) identity with FiVB The original sample and a further 25 symptomatic and 10 asymptomatic fig samples, collected from the Auckland area between 2016 and 2021, were tested using FiVB specific RT-PCR and Sanger sequencing using primers FiVB-F1 (5'-GAGGGAGAGATGTAGATGC-3') and FiVB-R2 (5'-TGTCGTCGATATCGTTGTGT-3'), designed to amplify a 725 nt fragment in the 70 kDa heat shock protein (HSP70) ORF. Products of the expected size were amplified from the original sample and three symptomatic samples and their sequences found to be identical. BLAST searches showed that the sequence (GenBank accession no. ON553403) shared 82.7% nt and 87.3% amino acid (aa) identity to an isolate of FiVB (GenBank accession no MN817233). These additional positive samples were collected from a small home nursery where the plants were propagated from cuttings and have been distributed locally, suggesting the virus is very likely to have a limited spread throughout the Auckland area. All three FiVB infected samples were also positive for FMV. However, the association of FiVB with FMD symptoms is unknown. FiVB was first identified from a latex sample exuded from a fig tree collected from Japan (Park et al. 2021) and is the only report of FiVB in the world to date. Although an identical sequence from Argentina, named fig closterovirus 1, was submitted to GenBank, the origin of this isolate is not known. To our knowledge, this is the first report of FiVB in New Zealand.

First report of Nerine yellow stripe virus infecting crinium lily (Crinium sp.) in Texas.

Crinum sp. (family Amaryllidaceae) is an ornamental flower bulb that is commonly called crinum lily, cape lily, cemetery plant, spider lily, and swamp lily. In April 2023, two plants of Crinum sp. var. Maiden's Blush with yellow stripe symptoms (Fig. S1) were submitted to the Texas Plant Virus Diagnostic Laboratory, Weslaco, TX for virus diagnosis. Due to the resemblance of the observed symptoms to those described for potyviruses infecting ornamental flower bulbs (Pearson et al. 2009), total RNA extracts were made from each sample using the SpectrumTM Plant Total RNA Kit (Sigma-Aldrich, USA), according to the manufacturer's protocol. Complementary DNA (cDNA) was synthesized from 2 µg total RNA per sample with Oligo(dT) primers using the PrimeScript™ 1st strand cDNA Synthesis Kit (Takara Bio, USA) as recommended by the manufacturer. A 2µL aliquot of each cDNA template was initially subjected to PCR using the generic primer pair CIFor/CIRev (Ha et al., 2008) that targets a fragment of the cylindrical inclusion (CI) body of potyviruses. The expected ~700 bp DNA band was amplified from both samples using the Taq DNA polymerase, dNTPack kit (Sigma-Aldrich). The amplicons were cloned and sequenced (three recombinant clones per sample) as described by Hernandez et al. (2021) and the BLASTX analyses of the consensus sequence (GenBank acc. no. OR137018) returned significant hits only to nerine yellow stripe virus (NeYSV; Potyvirus, Potyviridae) at 100% query coverage. To further confirm the results, another pair of universal primers (Jordan et al. 2011) was used to amplify the expected ∼1,600 bp product specific to the partial nuclear inclusion body (NIb), coat protein (CP) cistron, and 3' untranslated region of potyviruses from the same samples. The amplicons were similarly cloned, and a consensus sequence obtained (OR137019). In pairwise comparisons, the partial CI sequence of NeYSV from Texas (NeYSV-TX; OR137018) shared 83% nucleotide (nt)/93% amino acids (aa) identities with the corresponding sequences of NeYSV isolate 63 (MT396083) from the United Kingdom. The partial (649 nt) NIb sequences of NeYSV-TX (OR137019) and the complete CP (OR137019) of NeYSV-TX shared 77-94%/88-94% and 83-99%/89-98% nt/aa identities with the corresponding sequences of global NeYSV isolates that were retrieved from GenBank. Phylogenetic analysis revealed a closer relationship between NeYSV-TX and the isolates Stenomesson (EU042758) and DC (MG012805) from the Netherlands and USA, respectively based on the partial NIb and CP cistrons (Fig. S2), suggesting that NeYSV-TX may have been introduced from foreign and/or domestic sources. NeYSV has been documented previously from the United Kingdom, the Netherlands, Australia, New Zealand, and India; its first report from the United States was a decade ago from Amaryllis belladonna in California (Guaragna et al. 2013). To the best of our knowledge, this is the first report of NeYSV in Texas, thus expanding the geographical range of the virus in the USA. Anecdotal information from the sample submitter implicated infected crinum lily bulbs as the likely source of NeYSV introduction into the property, with subsequent vegetative propagation of plants resulting in 100% incidence of symptomatic lilies (n>100) over time. Thus, the results underscore the importance of ensuring that only virus-free vegetative plant materials are distributed and propagated by florists to curtail virus spread.

Detection of SPV2 and SPCSV and their possible influence on the yield in multiple virus infections

AbstractThe prevalence of Sweet potato virus 2 (SPV2) and Sweet potato chlorotic stunt virus (SPCSV) in the Limpopo, Mpumalanga, and Gauteng provinces of South Africa was determined using serological and nucleic acid based methods. Cloning and sequencing part of the coat protein (CP) gene and the complete genome using next generation sequencing (NGS) were also conducted to characterize and determine the sequence variability in SPV2 isolates. Primers designed in the current study successfully detected and confirmed the prevalence of SPV2 in the three provinces surveyed. The pairwise comparison of the amino acid (aa) sequences encoding the CP gene region confirmed that isolates in this study are related to SPV2, sharing a 94% to 99% CP aa identity with those originally reported in South Africa. The East African (EA) strain of SPCSV was also detected in the three provinces surveyed. Phylogenetic analysis using part of the CP encoding nucleotide (nt) sequences showed that the South African isolates correspond to but are distinct from the other EA strains of SPCSV used as reference sequences. Assessment of varieties and breeding lines’ response to multiple infection of potyviruses identified variety NC1560, breeding lines 2002‐21‐1 and 2006‐5‐4 as promising for inclusion in future breeding programs as sources of parent material for virus tolerance.

First Report of Narcissus late season yellows virus, Narcissus latent virus, and Narcissus mosaic virus in daffodil (Narcissus pseudonarcissus) in the United States.

Daffodils (family Amaryllidaceae, genus Narcissus) are important ornamental plants produced primarily for cut flowers. In 2019, daffodils sales in the US were $6.26 M (USDA-NASS, 2019). In May 2021, four symptomatic daffodil plants (Narcissus pseudonarcissus) were sampled from a flowerbed (<10% disease incidence) on the Utah State University campus, Logan, Utah. The plants had foliar mosaic and yellow striping symptoms like those caused by the infections of Narcissus degeneration virus (NDV, a potyvirus) and Narcissus mosaic virus (NMV, a potexvirus) (Hanks and Chastagner 2017), and tested positive for potyviruses by ELISA Potyvirus group test (Agdia, Elkhart, IN). A sample of two leaves from the only surviving plant was sent to the USDA Plant Pathogen Confirmatory Diagnostics Laboratory (PPCDL) for testing. Total RNA extracted from 0.2 g pooled tissues (0.1g per leaf) using RNeasy Plant Mini kit (Qiagen) was tested for potyvirus in RT-PCR using Nib2F & Nib3R primers (Zheng et al. 2010). Later, the sample was tested for Narcissus latent virus (NLV) and NMV by RT-PCR (He et al. 2018) after the viruses were detected by high throughput sequencing (HTS) described below. A second primer pair was designed in-house targeting NMV TGB1 protein (NMV-2F: CCTTACACCACCGATCCTAAAG & NMV-2R: GGAGCTGCAGTGATGACATATAG. Amplicon size =555bp). The nucleotide (nt) sequence of the potyvirus RT-PCR product obtained (281 bp; GenBank accession no. ON653017) shared 99.29% identity with Narcissus late season yellows virus (NLSYV) BC 37 isolate (MH886515). The nt sequence of NLV-specific primer amplified product (542 bp; ON653018) showed 97.60% identity with NLV NL isolate (KX979913), a maculavirus. The amplicons obtained using two NMV-specific primer pairs were 348 bp (ON653019) and 524 bp (ON653020) long and shared 89.37% and 91.98% nt sequence identities with NMV SW13-Iris isolate (KF752593) at two genomic regions (5613-6860 nt and 5477-6000 nt), respectively. To obtain full genome sequences of the viruses in the sample, HTS was done. A cDNA library was prepared from 500 ng total RNA using the Direct cDNA sequencing kit (SQK-DCS109). The library was loaded onto an R9.4.1 MinION flow cell and sequenced for 48 hours. A total of 372,000 raw reads were obtained with a N50 of 2,754 bp and mean read length of 1,890 bp with 8,085 reads mapped to the viral database. Reads were assembled using canu v 2.1.1 (Koren et al. 2017). Three full-length viral contigs, ON677368 (6955 nt), ON677369 (9624 nt), and ON677370 (8180 nt), were assembled from 4616, 301, and 699 reads, respectively. BLASTn search showed that the three contigs (ON677368, ON677369, and ON677370) shared 94.42% nt identity with NMV SW13-Iris (KF752593), 98.56% with NLSYV BC 37 (MH886515.1), and 98.60% with NLV NL (KX979913.1) isolates, respectively. The potexvirus group, which NMV is a member, has species demarcation of < 72% nt identity (or 80% aa identity) between their coat protein or replicase genes (ICTV 2021). The predicted replicase protein sequence (1643 aa) of the detected NMV (ON677368) showed 95% identity with a published NMV genome (P15059), confirming its identity. NDV was not detected in the sample by RT-PCR and HTS. This is the first report of NLMV, NLSYV, and NMV in daffodil plants in the United States. Daffodils are an important ornamental crop in United States and Europe. A reduction in flower quality, bulb size, and number has been observed in plants infected with these viruses (Ward et al. 2009) that can affect their marketability.

Genus-wide genomic characterization of Macrococcus: insights into evolution, population structure, and functional potential.

Macrococcus species have been isolated from a range of mammals and mammal-derived food products. While they are largely considered to be animal commensals, Macrococcus spp. can be opportunistic pathogens in both veterinary and human clinical settings. This study aimed to provide insight into the evolution, population structure, and functional potential of the Macrococcus genus, with an emphasis on antimicrobial resistance (AMR) and virulence potential. All high-quality, publicly available Macrococcus genomes (n = 104, accessed 27 August 2022), plus six South African genomes sequenced here (two strains from bovine clinical mastitis cases and four strains from beef products), underwent taxonomic assignment (using four different approaches), AMR determinant detection (via AMRFinderPlus), and virulence factor detection (using DIAMOND and the core Virulence Factor Database). Overall, the 110 Macrococcus genomes were of animal commensal, veterinary clinical, food-associated (including food spoilage), and environmental origins; five genomes (4.5%) originated from human clinical cases. Notably, none of the taxonomic assignment methods produced identical results, highlighting the potential for Macrococcus species misidentifications. The most common predicted antimicrobial classes associated with AMR determinants identified across Macrococcus included macrolides, beta-lactams, and aminoglycosides (n = 81, 61, and 44 of 110 genomes; 73.6, 55.5, and 40.0%, respectively). Genes showing homology to Staphylococcus aureus exoenzyme aureolysin were detected across multiple species (using 90% coverage, n = 40 and 77 genomes harboring aureolysin-like genes at 60 and 40% amino acid [AA] identity, respectively). S. aureus Panton-Valentine leucocidin toxin-associated lukF-PV and lukS-PV homologs were identified in eight M. canis genomes (≥40% AA identity, >85% coverage). Using a method that delineates populations using recent gene flow (PopCOGenT), two species (M. caseolyticus and M. armenti) were composed of multiple within-species populations. Notably, M. armenti was partitioned into two populations, which differed in functional potential (e.g., one harbored beta-lactamase family, type II toxin-antitoxin system, and stress response proteins, while the other possessed a Type VII secretion system; PopCOGenT p < 0.05). Overall, this study leverages all publicly available Macrococcus genomes in addition to newly sequenced genomes from South Africa to identify genomic elements associated with AMR or virulence potential, which can be queried in future experiments.

Survey, Detection, Characterization of Papaya Ringspot Virus from Southern India and Management of Papaya Ringspot Disease.

Papaya ringspot virus (PRSV) is a significant threat to global papaya cultivation, causing ringspot disease, and it belongs to the species Papaya ringspot virus, genus Potyvirus, and family Potyviridae. This study aimed to assess the occurrence and severity of papaya ringspot disease (PRSD) in major papaya-growing districts of Karnataka, India, from 2019 to 2021. The incidence of disease in the surveyed districts ranged from 50.5 to 100.0 percent, exhibiting typical PRSV symptoms. 74 PRSV infected samples were tested using specific primers in RT-PCR, confirming the presence of the virus. The complete genome sequence of a representative isolate (PRSV-BGK: OL677454) was determined, showing the highest nucleotide identity (nt) (95.8%) with the PRSV-HYD (KP743981) isolate from Telangana, India. It also shared an amino acid (aa) identity (96.5%) with the PRSV-Pune VC (MF405299) isolate from Maharashtra, India. Based on phylogenetic and species demarcation criteria, the PRSV-BGK isolate was considered a variant of the reported species and designated as PRSV-[IN:Kar:Bgk:Pap:21]. Furthermore, recombination analysis revealed four unique recombination breakpoint events in the genomic region, except for the region from HC-Pro to VPg, which is highly conserved. Interestingly, more recombination events were detected within the first 1710 nt, suggesting that the 5' UTR and P1 regions play an essential role in shaping the PRSV genome. To manage PRSD, a field experiment was conducted over two seasons, testing various treatments, including insecticides, biorationals, and a seaweed extract with micronutrients, alone or in combination. The best treatment involved eight sprays of insecticides and micronutrients at 30-day intervals, resulting in no PRSD incidence up to 180 days after transplanting (DAT). This treatment also exhibited superior growth, yield, and yield parameters, with the highest cost-benefit ratio (1:3.54) and net return. Furthermore, a module comprising 12 sprays of insecticides and micronutrients at 20-day intervals proved to be the most effective in reducing disease incidence and enhancing plant growth, flowering, and fruiting attributes, resulting in a maximized yield of 192.56 t/ha.

Genomic characterization of the rotavirus G3P[8] strain in vaccinated children, reveals possible reassortment events between human and animal strains in Manhiça District, Mozambique.

Mozambique introduced the rotavirus vaccine (Rotarix®; GlaxoSmithKline Biologicals, Rixensart, Belgium) in 2015, and since then, the Centro de Investigação em Saúde de Manhiça has been monitoring its impact on rotavirus-associated diarrhea and the trend of circulating strains, where G3P[8] was reported as the predominant strain after the vaccine introduction. Genotype G3 is among the most commonly detected Rotavirus strains in humans and animals, and herein, we report on the whole genome constellation of G3P[8] detected in two children (aged 18 months old) hospitalized with moderate-to-severe diarrhea at the Manhiça District Hospital. The two strains had a typical Wa-like genome constellation (I1-R1-C1-M1-A1-N1-T1-E1-H1) and shared 100% nucleotide (nt) and amino acid (aa) identities in 10 gene segments, except for VP6. Phylogenetic analysis demonstrated that genome segments encoding VP7, VP6, VP1, NSP3, and NSP4 of the two strains clustered most closely with porcine, bovine, and equine strains with identities ranging from 86.9-99.9% nt and 97.2-100% aa. Moreover, they consistently formed distinct clusters with some G1P[8], G3P[8], G9P[8], G12P[6], and G12P[8] strains circulating from 2012 to 2019 in Africa (Mozambique, Kenya, Rwanda, and Malawi) and Asia (Japan, China, and India) in genome segments encoding six proteins (VP2, VP3, NSP1-NSP2, NSP5/6). The identification of segments exhibiting the closest relationships with animal strains shows significant diversity of rotavirus and suggests the possible occurrence of reassortment events between human and animal strains. This demonstrates the importance of applying next-generation sequencing to monitor and understand the evolutionary changes of strains and evaluate the impact of vaccines on strain diversity.

Genomic characterization and seed transmission of a novel unclassified partitivirus infecting Polygonatum kingianum Coll. et Hemsl

This study identified a novel virus in the family Partitiviridae infecting Polygonatum kingianum Coll. et Hemsl, which is tentatively named polygonatum kingianum cryptic virus 1 (PKCV1). PKCV1 genome has two RNA segments: dsRNA1 (1926 bp) has an open reading frame (ORF) encoding an RNA-dependent RNA polymerase (RdRp) of 581 amino acids (aa), and dsRNA2 (1721 bp) has an ORF encoding a capsid protein (CP) of 495 aa. The RdRp of PKCV1 shares 20.70–82.50% aa identity with known partitiviruses, and the CP of PKCV1 shares 10.70–70.80% aa identity with known partitiviruses. Moreover, PKCV1 phylogenetically clustered with unclassified members of the Partitiviridae family. Additionally, PKCV1 is common in P. kingianum planting regions and has a high infection rate in P. kingianum seeds.

Frankia alni Carbonic Anhydrase Regulates Cytoplasmic pH of Nitrogen-Fixing Vesicles.

A phyloprofile of Frankia genomes was carried out to identify those genes present in symbiotic strains of clusters 1, 1c, 2 and 3 and absent in non-infective strains of cluster 4. At a threshold of 50% AA identity, 108 genes were retrieved. Among these were known symbiosis-associated genes such as nif (nitrogenase), and genes which are not know as symbiosis-associated genes such as can (carbonic anhydrase, CAN). The role of CAN, which supplies carbonate ions necessary for carboxylases and acidifies the cytoplasm, was thus analyzed by staining cells with pH-responsive dyes; assaying for CO2 levels in N-fixing propionate-fed cells (that require a propionate-CoA carboxylase to yield succinate-CoA), fumarate-fed cells and N-replete propionate-fed cells; conducting proteomics on N-fixing fumarate and propionate-fed cells and direct measurement of organic acids in nodules and in roots. The interiors of both in vitro and nodular vesicles were found to be at a lower pH than that of hyphae. CO2 levels in N2-fixing propionate-fed cultures were lower than in N-replete ones. Proteomics of propionate-fed cells showed carbamoyl-phosphate synthase (CPS) as the most overabundant enzyme relative to fumarate-fed cells. CPS combines carbonate and ammonium in the first step of the citrulline pathway, something which would help manage acidity and NH4+. Nodules were found to have sizeable amounts of pyruvate and acetate in addition to TCA intermediates. This points to CAN reducing the vesicles' pH to prevent the escape of NH3 and to control ammonium assimilation by GS and GOGAT, two enzymes that work in different ways in vesicles and hyphae. Genes with related functions (carboxylases, biotin operon and citrulline-aspartate ligase) appear to have undergone decay in non-symbiotic lineages.