AA Dinucleotides Research Articles

Molecular mechanism for regulating APOBEC3G DNA editing function by the non-catalytic domain

APOBEC3G, part of the AID/APOBEC cytidine deaminase family, is crucial for antiviral immunity. It has two zinc-coordinated cytidine-deaminase domains. The non-catalytic N-terminal domain strongly binds to nucleic acids, whereas the C-terminal domain catalyzes C-to-U editing in single-stranded DNA. The interplay between the two domains is not fully understood. Here, we show that DNA editing function of rhesus macaque APOBEC3G on linear and hairpin loop DNA is enhanced by AA or GA dinucleotide motifs present downstream in the 3’-direction of the target-C editing sites. The effective distance between AA/GA and the target-C sites is contingent on the local DNA secondary structure. We present two co-crystal structures of rhesus macaque APOBEC3G bound to ssDNA containing AA and GA, revealing the contribution of the non-catalytic domain in capturing AA/GA DNA. Our findings elucidate the molecular mechanism of APOBEC3G’s cooperative function, which is critical for its antiviral role and its contribution to mutations in cancer genomes.

Identification of Extrachromosomal Linear microDNAs Interacted with microRNAs in the Cell Nuclei.

Extrachromosomal DNA exists in two forms: Covalently closed circular and linear. While diverse types of circular extrachromosomal DNA have been identified with validated in vivo functions, little is known about linear extrachromosomal DNA. In this study, we identified small, single-stranded linear extrachromosomal DNAs (SSLmicroDNAs) in the nuclei of mouse hearts, mouse brains, HEK293, and HeLa cells. We used a pull-down system based on the single-stranded DNA binding protein RecAf. We found that SSLmicroDNAs aligned predominantly to intergenic and intragenic regions of the genome, owned a variety of single nucleotide polymorphism sites, and strongly associated with H3K27Ac marks. The regions were tens to hundreds of nucleotides long, periodically separated by AT, TT, or AA dinucleotides. It has been demonstrated that SSLmicroDNAs in the nuclei of normal cells target microRNAs, which regulate biological processes. In summary, our present work identified a new form of extrachromosomal DNAs, which function inside nuclei and interact with microRNAs. This finding provides a possible research field into the function of extrachromosomal DNA.

The Approach to Generate Oncolytic Adenovirus by Sirna Mediated E1B Silencing

Background Adenovirus is a gene transfer vehicle used in anticancer biotherapy. Oncolytic adenoviruses are prepared so that the recombinant viruses possess more potent cytotoxicity to target cells. E1B is an anti-apoptotic protein encoded by adenovirus. In the present study we tested whether the potential antitumor activity of BLU recombinant adenovirus of tumour suppressor BLU could be enhanced by silencing E1B with siRNA. Methods The shuttle plasmid of BLU was constructed as described, and was assembled to be recombinant adenovirus. siRNAs against adenoviral E1B were designed by locating oligo?nucleotides downstream of AA dinucleotides within the genomic DNA sequence and chemically synthesised. Their ability to silence the expression of E1B was tested by transfection and anti-E1B Western blotting. The potential of BLU to inhibit in vitro and in vivo tumour cell growth was compared between siRNA transfected cells and controls. Results Up to 6 strains of siRNAs were designed and synthesised. They silenced the expression of E1B to different extents, and remarkably reduced the cell viability and formation of xenograted tumours in nude mice. Conclusion In addition to knockout of the E1B coding cassette, siRNA mediated E1B also serves as an approach to prepare oncolytic adenovirus. Acknowledgements Supported by grants from UICC (ICRETT Fellowship), Guangdong Commission of Health and Family Plan (Grant No. 2014A276).

Mechanism of bacterial gene rearrangement: SprA-catalyzed precise DNA recombination and its directionality control by SprB ensure the gene rearrangement and stable expression of spsM during sporulation in Bacillus subtilis.

A sporulation-specific gene, spsM, is disrupted by an active prophage, SPβ, in the genome of Bacillus subtilis. SPβ excision is required for two critical steps: the onset of the phage lytic cycle and the reconstitution of the spsM-coding frame during sporulation. Our in vitro study demonstrated that SprA, a serine-type integrase, catalyzed integration and excision reactions between attP of SPβ and attB within spsM, while SprB, a recombination directionality factor, was necessary only for the excision between attL and attR in the SPβ lysogenic chromosome. DNA recombination occurred at the center of the short inverted repeat motif in the unique conserved 16 bp sequence among the att sites (5΄-ACAGATAA/AGCTGTAT-3΄; slash, breakpoint; underlines, inverted repeat), where SprA produced the 3΄-overhanging AA and TT dinucleotides for rejoining the DNA ends through base-pairing. Electrophoretic mobility shift assay showed that SprB promoted synapsis of SprA subunits bound to the two target sites during excision but impaired it during integration. In vivo data demonstrated that sprB expression that lasts until the late stage of sporulation is crucial for stable expression of reconstituted spsM without reintegration of the SPβ prophage. These results present a deeper understanding of the mechanism of the prophage-mediated bacterial gene regulatory system.

Abstract 127: The genomic landscapes of inflammatory bowel disease-associated colorectal cancers

Abstract Long duration inflammatory bowel disease (IBD) increases the risk for colorectal cancer (CRC). Mutation analysis of limited numbers of genes has suggested that CRCs arising in an IBD background differ from those that do not. We sought to characterize the genetic landscape of these tumors through whole-exome sequencing. Thirty-one IBD patients with CRC were identified, including 15 with ulcerative colitis, 14 with Crohn's disease and 2 with indeterminate colitis. Whole-exome sequencing was performed on micro-dissected tumor and matched non-neoplastic formalin-fixed paraffin-embedded (FFPE) tissues. Somatic alterations were identified by comparing matched specimens. Mutation prevalence in sporadic CRC was obtained from previously published exome-sequencing studies. An average of 11.6 Gb were sequenced per sample. The depth of quality coverage of the targeted region was 29 to 100-fold in the tumors; and 17- to 123-fold in non-tumor samples. Two specimens harbored somatic mutations in the DNA proofreading or mismatch repair genes POLE, MLH1 and MSH6 and exhibited hypermutable phenotype. The remaining cases had a median mutation rate of 1.33 mutations/Mb and an average of 71 alterations per sample. The pattern of base changes in non-hypermutated tumors showed a preponderance of C to T transitions (62%), a majority of which (48% of all mutations) occurred at 5′-CpG-3′ sites. An excess of A to C transversions at AA dinucleotides, particularly in a context of AAG trinucleotides, was also noted. This pattern has been previously observed in esophageal and gastric cancers, both of which are also tied to chronic inflammation. There were no apparent differences in the spectrum of substitutions between tumors arising in UC and CD patients. We identified 28 genes recurrently mutated in three or more non-hypermutated samples. TP53 was the most commonly mutated gene, with incidence prevalence similar to sporadic CRC (63% of cases), but with different mutation spectrum. APC and KRAS were mutated at significantly lower rates than in sporadic CRCs (13% and 20% of cases, respectively). Genes mutated more commonly or uniquely in IBD-CRC, included SOX9 and EP300, encoding proteins in the WNT pathway, NRG1, encoding an ERBB ligand, and IL16, encoding a cytokine. Three cases featured hotspot PIK3CA mutations. Likely oncogenic driver gene mutations in BRAF, CTNNB1, and CREBBP were found in one case each. Mutated genes were enriched for gene ontologies associated with cell communication, cell-cell signaling, and cell adhesion. Our study also revealed recurrent mutations in components of the Rho/Rac GTPase network, suggesting a role for non-canonical WNT signaling in IBD-CRC. CRCs arising in IBD patients demonstrate a unique molecular profile, which provides clues to their etiology. Our study also sets the stage for improved early detection of IBD-associated CRCs based on their unique genetic compositions as well as for the tailoring of therapies in this patient population. Citation Format: Ana I. Robles, Giovanni Traverso, Ming Zhang, Nicholas Roberts, Mohammed A. Khan, Christine Joseph, Gregory Lauwers, Florin Selaru, Maria Popoli, Xiquan Ke, Ralph H. Hruban, Stephen J. Meltzer, Kenneth W. Kinzler, Bert Vogelstein, Curtis C. Harris, Nickolas Papadopoulos. The genomic landscapes of inflammatory bowel disease-associated colorectal cancers. [abstract]. In: Proceedings of the 107th Annual Meeting of the American Association for Cancer Research; 2016 Apr 16-20; New Orleans, LA. Philadelphia (PA): AACR; Cancer Res 2016;76(14 Suppl):Abstract nr 127.

TSS seq based core promoter architecture in blood feeding Tsetse fly (Glossina morsitans morsitans) vector of Trypanosomiasis.

BackgroundTranscription initiation regulation is mediated by sequence-specific interactions between DNA-binding proteins (transcription factors) and cis-elements, where BRE, TATA, INR, DPE and MTE motifs constitute canonical core motifs for basal transcription initiation of genes. Accurate identification of transcription start site (TSS) and their corresponding promoter regions is critical for delineation of these motifs. To this end, the genome scale analysis of core promoter architecture in insects has been confined to Drosophila. The recently sequenced Tsetse fly genome provides a unique opportunity to analyze transcription initiation regulation machinery in blood-feeding insects.ResultsA computational method for identification of TSS in newly sequenced Tsetse fly genome was evaluated, using TSS seq tags sampled from two developmental stages namely; larvae and pupae. There were 3134 tag clusters among which 45.4 % (1424) of the tag clusters mapped to first coding exons or their proximal predicted 5′UTR regions and 1.0 % (31) tag clusters mapping to transposons, within a threshold of 100 tags per cluster. These 1393 non transposon-derived core promoters had propensity for AT nucleotides. The −1/+1 and 1/+1 positions in D. melanogaster, and G. m. morsitans had propensity for CA and AA dinucleotides respectively. The 1393 tag clusters comprised narrow promoters (5 %), broad with peak promoters (23 %) and broad without peak promoters (72 %). Two-way motif co-occurrence analysis showed that the MTE-DPE pair is over-represented in broad core promoters. The frequently occurring triplet motifs in all promoter classes are the INR-MTE-DPE, TATA-MTE-DPE and TATA-INR-DPE. Promoters without the TATA motif had higher frequency of the MTE and INR motifs than those observed in Drosophila, where the DPE motif occur more frequently in promoters without TATA motif. Gene ontology terms associated with developmental processes were overrepresented in the narrow and broad with peak promoters.ConclusionsThe study has identified different motif combinations associated with broad promoters in a blood-feeding insect. In the case of TATA-less core promoters, G.m. morsitans uses the MTE to compensate for the lack of a TATA motif. The increasing availability of TSS seq data allows for revision of existing gene annotation datasets with the potential of identifying new transcriptional units.Electronic supplementary materialThe online version of this article (doi:10.1186/s12864-015-1921-6) contains supplementary material, which is available to authorized users.

Nucleosomes shape DNA polymorphism and divergence.

An estimated 80% of genomic DNA in eukaryotes is packaged as nucleosomes, which, together with the remaining interstitial linker regions, generate higher order chromatin structures [1]. Nucleosome sequences isolated from diverse organisms exhibit ∼10 bp periodic variations in AA, TT and GC dinucleotide frequencies. These sequence elements generate intrinsically curved DNA and help establish the histone-DNA interface. We investigated an important unanswered question concerning the interplay between chromatin organization and genome evolution: do the DNA sequence preferences inherent to the highly conserved histone core exert detectable natural selection on genomic divergence and polymorphism? To address this hypothesis, we isolated nucleosomal DNA sequences from Drosophila melanogaster embryos and examined the underlying genomic variation within and between species. We found that divergence along the D. melanogaster lineage is periodic across nucleosome regions with base changes following preferred nucleotides, providing new evidence for systematic evolutionary forces in the generation and maintenance of nucleosome-associated dinucleotide periodicities. Further, Single Nucleotide Polymorphism (SNP) frequency spectra show striking periodicities across nucleosomal regions, paralleling divergence patterns. Preferred alleles occur at higher frequencies in natural populations, consistent with a central role for natural selection. These patterns are stronger for nucleosomes in introns than in intergenic regions, suggesting selection is stronger in transcribed regions where nucleosomes undergo more displacement, remodeling and functional modification. In addition, we observe a large-scale (∼180 bp) periodic enrichment of AA/TT dinucleotides associated with nucleosome occupancy, while GC dinucleotide frequency peaks in linker regions. Divergence and polymorphism data also support a role for natural selection in the generation and maintenance of these super-nucleosomal patterns. Our results demonstrate that nucleosome-associated sequence periodicities are under selective pressure, implying that structural interactions between nucleosomes and DNA sequence shape sequence evolution, particularly in introns.

Comprehensive microRNA profiling of prostate cancer cells after ionizing radiation treatment

MicroRNAs (miRNAs) are small, non-coding RNAs that negatively regulate gene expression and have emerged as potential biomarkers in radiation response to human cancer. Only a few miRNAs have been identified in radiation response to prostate cancer and the involvement of the radiation-associated miRNA machinery in the response of prostate cancer cells to radiation is not thoroughly understood. Therefore, the purpose of the present study was to comprehensively investigate the expression levels, arm selection preference and isomiRs of radiation-response miRNAs in radiation-treated PC3 cells using a next-generation sequencing (NGS) approach. Our data revealed that the arm selection preference and 3′ modification of miRNAs may be altered in prostate cancer after radiation exposure. In addition, the proportion of AA dinucleotide modifications at the end of the read gradually increased in a time-dependent manner after PC3 radiation treatment. We also identified 6 miRNAs whose expression increased and 16 miRNAs whose expression decreased after exposure to 10 Gy of radiation. A pathway enrichment analysis revealed that the target genes of these radiation-induced miRNAs significantly co-modulated the radiation response pathway, including the mitogen-activated protein kinase (MAPK), Wnt, transforming growth factor-β (TGF-β) and ErbB signaling pathways. Furthermore, analysis of The Cancer Genome Atlas (TCGA) database revealed that the expression of these radiation-induced miRNAs was frequently dysregulated in prostate cancer. Our study identified radiation-induced miRNA candidates which may contribute to radiosensitivity and can be used as biomarkers for radiotherapy.

Visible periodicity of strong nucleosome DNA sequences

Fifteen years ago, Lowary and Widom assembled nucleosomes on synthetic random sequence DNA molecules, selected the strongest nucleosomes and discovered that the TA dinucleotides in these strong nucleosome sequences often appear at 10–11 bases from one another or at distances which are multiples of this period. We repeated this experiment computationally, on large ensembles of natural genomic sequences, by selecting the strongest nucleosomes – i.e. those with such distances between like-named dinucleotides, multiples of 10.4 bases, the structural and sequence period of nucleosome DNA. The analysis confirmed the periodicity of TA dinucleotides in the strong nucleosomes, and revealed as well other periodic sequence elements, notably classical AA and TT dinucleotides. The matrices of DNA bendability and their simple linear forms – nucleosome positioning motifs – are calculated from the strong nucleosome DNA sequences. The motifs are in full accord with nucleosome positioning sequences derived earlier, thus confirming that the new technique, indeed, detects strong nucleosomes. Species- and isochore-specific variations of the matrices and of the positioning motifs are demonstrated. The strong nucleosome DNA sequences manifest the highest hitherto nucleosome positioning sequence signals, showing the dinucleotide periodicities in directly observable rather than in hidden form.

Exome and whole-genome sequencing of esophageal adenocarcinoma identifies recurrent driver events and mutational complexity.

The incidence of esophageal adenocarcinoma (EAC) has risen 600% over the last 30 years. With a five-year survival rate of 15%, identification of new therapeutic targets for EAC is greatly important. We analyze the mutation spectra from whole exome sequencing of 149 EAC tumors/normal pairs, 15 of which have also been subjected to whole genome sequencing. We identify a mutational signature defined by a high prevalence of A to C transversions at AA dinucleotides. Statistical analysis of exome data identified significantly mutated 26 genes. Of these genes, four (TP53, CDKN2A, SMAD4, and PIK3CA) have been previously implicated in EAC. The novel significantly mutated genes include chromatin modifying factors and candidate contributors: SPG20, TLR4, ELMO1, and DOCK2. Functional analyses of EAC-derived mutations in ELMO1 reveal increased cellular invasion. Therefore, we suggest a new hypothesis about the potential activation of the RAC1 pathway to be a contributor to EAC tumorigenesis.

Mapping of positive selection sites in the HIV-1 genome in the context of RNA and protein structural constraints

BackgroundThe HIV-1 genome is subject to pressures that target the virus resulting in escape and adaptation. On the other hand, there is a requirement for sequence conservation because of functional and structural constraints. Mapping the sites of selective pressure and conservation on the viral genome generates a reference for understanding the limits to viral escape, and can serve as a template for the discovery of sites of genetic conflict with known or unknown host proteins.ResultsTo build a thorough evolutionary, functional and structural map of the HIV-1 genome, complete subtype B sequences were obtained from the Los Alamos database. We mapped sites under positive selective pressure, amino acid conservation, protein and RNA structure, overlapping coding frames, CD8 T cell, CD4 T cell and antibody epitopes, and sites enriched in AG and AA dinucleotide motives. Globally, 33% of amino acid positions were found to be variable and 12% of the genome was under positive selection. Because interrelated constraining and diversifying forces shape the viral genome, we included the variables from both classes of pressure in a multivariate model to predict conservation or positive selection: structured RNA and α-helix domains independently predicted conservation while CD4 T cell and antibody epitopes were associated with positive selection.ConclusionsThe global map of the viral genome contains positive selected sites that are not in canonical CD8 T cell, CD4 T cell or antibody epitopes; thus, it identifies a class of residues that may be targeted by other host selective pressures. Overall, RNA structure represents the strongest determinant of HIV-1 conservation. These data can inform the combined analysis of host and viral genetic information.

A Conserved Regulatory Element in the Mammalian β-Globin Promoters

We provide here evidence for a conserved regulatory element for transcription of the β-family globin genes based on a comparative study of 32 genes from 16 mammals. The element is characterized by the appearance of AA or TT dinucleotides in the A+T-rich region located 200-400bp upstream of the cap sites. G-tracts 3-5 nucleotides long exist between the A+T-rich region and the conserved transcription factor binding sites (GATA-1 site and the CACCC, CCAAT, and ATA boxes) apparently dividing the regions. The average periodicity of AA or TT dinucleotides in the region from a total of 18 β-family globin genes from four species was approximately 10bp, suggesting that the DNA in these regions shows right-handed superhelicity. The proposed biological function of this element is to adjust the spatial positions for the first interaction of the transcription factor(s) which can recognize specific DNA sequences in the presence of packed chromatin.

Variety of genomic DNA patterns for nucleosome positioning

Precise positioning of nucleosomes along DNA is important for a variety of gene regulatory processes. Among the factors directing nucleosome positioning, the DNA sequence is highly important. Two main classes of nucleosome positioning sequence (NPS) patterns have previously been described. In the first class, AA, TT, and other WW dinucleotides (where W is A or T) tend to occur together (in-phase) in the major groove of DNA closest to the histone octamer surface, while SS dinucleotides (where S is G or C) are predominantly positioned in the major groove facing outward. In the second class, AA and TT are structurally separated (AA backbone near the histone octamer, and TT backbone further away), but grouped with other RR (where R is purine A or G) and YY (where Y is pyrimidine C or T) dinucleotides. As a result, the RR/YY pattern includes counter-phase AA/TT distributions. We describe here anti-NPS patterns, which are inverse to the conventional NPS patterns: WW runs inverse to SS, and RR inverse to YY. Evidence for the biological relevance of anti-NPS patterns is presented.

Sequence Structure of Hidden 10.4-base Repeat in the Nucleosomes of C. elegans

By measuring prevailing distances between YY, YR, RR, and RY dinucleotides in the large database of the nucleosome DNA fragments from C. elegans, the consensus sequence structure of the nucleosome DNA repeat of C. elegans was reconstructed: (YYYYYRRRRR)n. An actual period was estimated to be 10.4 bases. The pattern is fully consistent with the nucleosome DNA patterns of other eukaryotes, as established earlier, and, thus, the YYYYYRRRRR repeat can be considered as consensus nucleosome DNA sequence repeat across eukaryotic species. Similar distance analysis for [A, T] dinucleotides suggested the related pattern (TTTYTARAAA)n where the TT and AA dinucleotides display rather out of phase behavior, contrary to the “AA or TT” in-phase periodicity, considered in some publications. A weak 5-base periodicity in the distribution of TA dinucleotides was detected.

Sequence Structure of Human Nucleosome DNA

Positional distributions of various dinucleotides in experimentally derived human nucleosome DNA sequences are analyzed. Nucleosome positioning in this species is found to depend largely on GG and CC dinucleotides periodically distributed along the nucleosome DNA sequence, with the period of 10.4 bases. The GG and CC dinucleotides oscillate counterphase, i.e., their respective preferred positions are shifted about a half-period from one another, as it was observed earlier for AA and TT dinucleotides. Other purine-purine and pyrimidine-pyrimidine dinucleotides (RR and YY) display the same periodical and counterphase pattern. The dominance of oscillating GG and CC dinucleotides in human nucleosomes and the contribution of AG(CT), GA(TC), and AA(TT) suggest a general nucleosome DNA sequence pattern—counterphase oscillation of RR and YY dinucleotides. AA and TT dinucleotides, commonly accepted as major players, are only weak contributors in the case of human nucleosomes.

Specific Selection Pressure at the Third Codon Positions: Contribution to 10- to 11-Base Periodicity in Prokaryotic Genomes

Prokaryotic sequences are responsible for more than just protein coding. There are two 10- to 11-base periodical patterns superimposed on the protein coding message within the same sequence. Positional auto- and cross-correlation analysis of the sequences shows that these two patterns are a short-range counter-phase oscillation of AA and TT dinucleotides and a medium-range in-phase oscillation of the same dinucleotides, spanning distances of up to approximately 30 and approximately 100 bases, respectively. The short-range oscillation is encoded by the amino acid sequences themselves, apparently, due to the presence of amphipathic alpha-helices in the proteins. The medium-range oscillation, related to DNA folding in the cell, is created largely by a special choice of the bases in the third positions of the codons. Interestingly, the amino acid sequences do contribute to that signal as well. That is, the very amino acid sequences are, to some extent, degenerate to serve the same oscillating pattern that is associated with the degenerate third codon positions.

Three Sequence Rules for Chromatin

Extensive DNA sequence analysis of three eukaryotes, S. cerevisiae, C. elegans, and D. melanogaster, reveals two different AA/TT periodical patterns associated with the nucleosome positioning. The first pattern is the counter-phase oscillation of AA and TT dinucleotides, which has been frequently considered as the nucleosome DNA pattern. This represents the sequence rule I for chromatin structure. The second pattern is the in-phase oscillation of the AA and TT dinucleotides with the same nucleosome DNA period, 10.4 bases. This pattern apparently corresponds to curved DNA, that also participates in the nucleosome formation, and represents the sequence rule II for chromatin. The positional correlations of AA and TT dinucleotides also indicate that the nucleosomes are separated by specific linker sizes (preferably 8, 18,…bases), dictated by the steric exclusion rules. Thus, the sequence positions of the neighboring nucleosomes are correlated, and this represents the sequence rule III.

Nucleotide changes around the splicing acceptor of intron 24 in the factor VIII gene and its impact on splicing

Nucleotide 6724 of the factor VIII gene harbors a polymorphism of low frequency. A report from Taiwan claimed that 97.9% of the 83 alleles examined were of the A nucleotide at this position, which is quite different to the data from Western populations. Furthermore, this nucleotide is the start of exon 25, located in juxtaposition to the splicing acceptor of intron 24. We wonder if the nucleotide change at this location might have any effect on the splicing process of pre-mRNA. Using genomic DNA with direct sequencing of the polymerase chain reaction-amplified intron 24/exon 25 junction site, we found that 59 of the 60 patient samples were of the GTG sequence at nucleotides 6724-6726. The polymorphism is similar between populations in Taiwan and Western countries. The sequence of intron 24 around the splicing acceptor was always TCCAACTCTATTGCCCTCAG (-20 to -1), except for one hemophiliac patient who had a mutation in which the absolute consensus AG doublet of the intron 24 splicing acceptor changed to the AA dinucleotide. Owing to the mutation, exon 24 was erroneously spliced to exon 26, and exon 25 was skipped. This finding further testifies to the importance of the invariant AG dinucleotide in the example of the factor VIII gene.

Yeast Nucleosome DNA Pattern: Deconvolution from Genome Sequences of S. cerevisiae

Positional correlation analysis for the complete genome of Saccharomyces cerevisiae is performed with the aim to reveal possible chromatin-related sequence features. A strong periodicity with the period 10.4 bases is detected in the distance histograms for the dinucleotides AA and TT, with the characteristic decay distance of approximately 50 base pairs. The oscillations are observed as well in the distributions of other dinucleotides. However, the respective amplitudes are small, consistent with secondary effects, due to dominant periodicity of AA and TT. The observations are in accord with earlier data on the chromatin sequence periodicities and nucleosome DNA sequence patterns. The autocorrelations of AA and TT dinucleotides in yeast include also a counter-phase component. A tentative DNA sequence pattern for the yeast nucleosomes is suggested and verified by comparison of its autocorrelation plots with the respective natural autocorrelations. The nucleosome mapping guided by the pattern is in accord with experimental data on the linker length distribution in yeast.

Gene splice sites correlate with nucleosome positions

Gene sequences in the vicinity of splice sites are found to possess dinucleotide periodicities, especially RR and YY, with the period close to the pitch of nucleosome DNA. This confirms previously reported findings about preferential positioning of splice junctions within the nucleosomes. The RR and YY dinucleotides oscillate counter-phase, i.e., their respective preferred positions are shifted about half-period from one another, as it was observed earlier for AA and TT dinucleotides. Species specificity of nucleosome positioning DNA pattern is indicated by the predominant use of the periodical GG(CC) dinucleotides in human and mouse genes, as opposed to predominant AA(TT) dinucleotides in Arabidopsis and C. elegans.