24-hour Urinary Calcium Excretion Research Articles

Chronic Fructose and Sucrose Intake and 24-Hour Urine Composition.

Consumption of sugar, including fructose and sucrose, is associated with higher risk of kidney stones. The association is thought to be due to an acute rise in urine calcium after sugar intake. However, the association between chronic sugar intake and urine composition is not known. We conducted a cross-sectional analysis of dietary intake from a food frequency questionnaire and 24-hour urine collections from 6,457 kidney stone and non-stone former participants from the Nurses' Health Study I (1,297), Nurses' Health Study II (4,053), and Health Professionals Follow-up Study (1,107). We used multivariate adjusted linear regression to examine the association between long-term intake of free fructose, total fructose, and sucrose and 24-hour urine composition. Higher free and total fructose and sucrose intake were each associated with lower 24-hour urine calcium. Comparing the highest vs lowest quintiles, mean urine calcium was 23 (31 to 15) mg/day lower for free fructose (p-trend <0.001), 26 (34 to 18) mg/day for total fructose (p-trend <0.001), and 8 (17 to 1) mg/day lower for sucrose (p-trend 0.03). Higher total fructose intake was associated with slightly higher calcium phosphate supersaturation (p-trend 0.002), and higher sucrose intake was associated with higher calcium oxalate (p-trend 0.03) and calcium phosphate (p-trend <0.001) supersaturations. Differences in 24-hour urine calcium were similar between kidney stone and non-stone former participants. In contrast to the acute rise in urine calcium previously seen in short-term studies, higher long-term intake of free and total fructose and sucrose was associated with lower 24-hour urine calcium excretion in those with and without a history of kidney stones. Other modest differences in urine composition were noted for each sugar. Future studies should test potential mechanisms for the observed lower 24-hour urine calcium with chronic sugar intake.

Evaluation of Drug-Drug Interaction Between Henagliflozin and Hydrochlorothiazide in Healthy Chinese Volunteers.

Henagliflozin is an original, selective sodium-glucose cotransporter 2 (SGLT2) inhibitor. Hydrochlorothiazide (HCTZ) is a common anti-hypertensive drug. This study aimed to evaluate the potential interaction between henagliflozin and HCTZ. This was a single-arm, open-label, multi-dose, three-period study that was conducted in healthy Chinese volunteers. Twelve subjects were treated in three periods, period 1: 25 mg HCTZ for four days, period 2: 10 mg henagliflozin for four days and period 3: 25 mg HCTZ + 10 mg henagliflozin for four days. Blood samples and urine samples were collected before and up to 24 hours after drug administrations on day 4, day 10 and day 14. The plasma concentrations of henagliflozin and HCTZ were analyzed using LC-MS/MS. The urine samples were collected for pharmacodynamic glucose and electrolyte analyses. Tolerability was also evaluated. The 90% CI of the ratio of geometric means (combination: monotherapy) for AUCτ,ss of henagliflozin and HCTZ was within the bioequivalence interval of 0.80-1.25. For henagliflozin, co-administration increased Css, max by 24.32% and the 90% CI of the GMR was (108.34%, 142.65%), and the 24-hour urine volume and glucose excretion decreased by 0.43% and 19.6%, respectively. For HCTZ, co-administration decreased Css, max by 19.41% and the 90% CI of the GMR was (71.60%, 90.72%), and the 24-hour urine volume and urinary calcium, potassium, phosphorus, chloride, and sodium excretion decreased by 11.7%, 20.8%, 11.8%, 11.9%, 22.0% and 15.5%, respectively. All subjects (12/12) reported adverse events (AEs), but the majority of theses AEs were mild and no serious AEs were reported. Although Css,max was affected by the combination of henagliflozin and HCTZ, there was no clinically meaningful safety interaction between them. Given these results, coadministration of HCTZ should not require any adaptation of henagliflozin dosing. ClinicalTrials.gov NCT06083116.

Extended Treatment With Recombinant Human Parathyroid Hormone (1-84) in Adult Patients With Chronic Hypoparathyroidism

ObjectiveRecombinant human parathyroid hormone (1-84) (rhPTH[1-84]) is efficacious in patients with hypoparathyroidism but additional data supporting its prolonged use are needed. We evaluated whether efficacy, safety, and tolerability are maintained during long-term rhPTH(1-84) treatment of patients with chronic hypoparathyroidism. MethodsThis was a phase 4, single-center, open-label, single-arm, 3-year extension (NCT02910466) of the phase 3 Hypo Extended (HEXT) study (NCT01199614). Patients self-administered rhPTH(1-84) once daily by subcutaneous injection, with doses individualized based on clinical parameters. Albumin-adjusted serum calcium levels (primary outcome measure), other disease biomarkers, health-related quality of life, and safety of rhPTH(1-84) were assessed using descriptive statistics. ResultsAll patients (n = 39) had been exposed to rhPTH(1-84) (mean exposure [SD] 8.5 [3.5] years) before the start of the study, resulting in a mean exposure of 10.8 years including the present study. Mean patient age was 51.9 years, 79.5% were female, and 97.4% were White. Mean albumin-adjusted serum calcium concentrations were within the target range, and mean serum phosphate, serum calcium-phosphate product, and 24-hour urinary calcium excretion levels were within reference ranges at end of treatment. Mean doses of supplemental calcium and active vitamin D were maintained throughout the study. Bone turnover marker levels were maintained from baseline to end of treatment. No clinically relevant changes in bone mineral density were observed. Patient-reported health-related quality-of-life scores were generally maintained throughout the study. Four adverse events were considered treatment related and no new safety signals were identified. ConclusionThe effects of rhPTH(1-84) on biochemical, skeletal, and health-related quality-of-life parameters did not wane with extended use.

SAT257 Efficacy Of Oral Cinacalcet In Non-PTH Non-Malignant Hypercalcemia From Excess 1,25 Dihydroxyvitamin D

Abstract Disclosure: S. Mohan: None. M.T. Sheehan: None. P.J. Tebben: None. R.A. Wermers: None. Introduction: Elevated 1,25-dihydroxyvitamin D (1,25(OH)2D) is a rare cause of non-parathyroid hormone (PTH) mediated hypercalcemia. An increase in the activating enzyme 1-alpha hydroxylase is seen in granulomatous diseases and lymphoma, while mutations in the CYP24A1 gene leads to reduced catabolism of 1,25(OH)2D. Cinacalcet has been shown to successfully treat 1,25(OH)2D-mediated hypercalcemia of malignancy. Extrapolating this, we report 3 patients with non-malignant 1,25(OH)2D-mediated hypercalcemia treated with cinacalcet. Case Series: The patients (2 male and 1 female) were 55-71 years old. At presentation to our clinic, all had hypercalcemia with serum calcium concentrations between 10.6-11.5 mg/dL (normal, 8.8-10.2 mg/dL). PTH ranged between 16-35 pg/ml (normal 15-65 pg/ml), PTH-related peptide was normal in all patients, 25-hydroxyvitamin D was 32-51 ng/ml, and 1,25(OH)2D was inappropriately normal between 31-77 pg/ml (normal 18-78 pg/mL) in the setting of hypercalcemia and chronic kidney disease in 2 patients with estimated glomerular filtration rates 35-42 ml/min. Other causes of hypercalcemia including sarcoidosis, tuberculosis and malignancy were ruled out. The female patient had hypercalciuria (288 mg/24 hours) without nephrolithiasis and both male patients had severe hypercalciuria (400-660 mg/24 hours) with recurrent nephrolithiasis. One male patient had biallelic variants in the CYP24A1 gene, while the other male patient was suspected to have similar mutations, but not identified on genetic testing. The female patient with a PTH of 35 pg/mL on our initial measurement had documented 1,25(OH)2D level of 82 pg/mL with PTH &amp;lt;20 pg/mL while previously hypercalcemic. Upon cinacalcet initiation all patients demonstrated normalization of calcium levels (8.6-9.5 mg/dl) with doses between 30-90 mg daily. The patient with CYP24A1 gene mutations experienced symptomatic hypocalcemia with calcium of 8.1 mg/dL requiring dose reduction and eventual discontinuation of cinacalcet due to limited clinical benefit. There were no consistent changes in 24-hour urine calcium or fractional excretion of calcium. Levels of 1,25(OH)2D increased and PTH decreased on cinacalcet while serum calcium levels were maintained within normal range, including 2 subjects with continued normocalcemia after 2 years of therapy. Conclusion: Cinacalcet may be a therapeutic option in non-malignant 1,25(OH)2D-mediated hypercalcemia. Further evaluation is needed to confirm efficacy, understand risks and benefits, and elucidate potential mechanisms of action. Mild decrease in PTH may lead to reduced skeletal calcium efflux while the maintenance of normocalcemia despite rising 1,25(OH)2D, which was also seen in our reported patients with malignant 1,25(OH)2D-mediated hypercalcemia, suggests cinacalcet may decrease intestinal calcium absorption. Presentation: Saturday, June 17, 2023

OR23-05 Log-term Efficacy And Safety Of Transcon PTH In Adults With Hypoparathyroidism: 52-week Results From The Open-label Extension Of The Phase 3 Pathway Trial

OR23-05 Log-term Efficacy And Safety Of Transcon PTH In Adults With Hypoparathyroidism: 52-week Results From The Open-label Extension Of The Phase 3 Pathway Trial

Normal 24-hour urine calcium concentrations after long-term daily oral intake of vitamin D in doses ranging from 5000 to 50,000 international units in 14 adult hospitalized psychiatric patients

Many controversies exist regarding vitamin D3 supplementation. These include not only diseases that are responsive to vitamin D supplementation, but also the long-term safety of prolonged daily oral vitamin D3 intake above 4000–10,000 International Units (IU). In particular, supplementation levels that do not result in adverse events, and the upper limits of safe serum 25-hydroxyvitamin D (25OHD) concentrations. Adverse reactions reported to occur with excessive vitamin D intake include hypercalcemia, renal failure, calcium crystal formation, undetectable parathyroid hormone concentrations, and hypercalciuria, all of which are reported to be reversible. To address the long-term safety of vitamin D supplementation, we previously reported data from patients in our hospital who have been voluntarily supplemented with vitamin D3 ranging from 5,000 to 10,000 IU/day since July 2011 as a standard of care for the prevention and treatment of vitamin D deficiency. Historically 90% of patients have agreed to daily supplementation, with most taking 10,000 IU/day. These data indicate no evidence for hypercalcemia, renal failure, calcium crystal formation, nephrolithiasis. or undetectable parathyroid hormone concentrations in patients taking 5000 or 10,000 IU/day for extended periods of time. As another measure for potential vitamin D toxicity, we retrospectively assessed 24-hour urine calcium excretion in 14 individuals on long-term daily oral vitamin D intake ranging from 5000 to 50,000 IU/day to further assess the safety of supplementation using these doses. This included patients taking either 5000 (4), 10,000 (9), or 50,000 (1) IU/day. Time on supplementation ranged from 10 to 102 months. A patient taking 400 IU/day and getting frequent sun exposure was also included. All fifteen 24-hour urine calcium measurements were normal. The current findings complement our experience with over 7000 patients in the past 13 years, indicating that prolonged daily oral intake of vitamin D3 ranging from 5000 to 10,000 IU/day is safe.

Nephrolithiasis and Multicystic Kidneys in a Young Patient: A Quiz

Nephrolithiasis and Multicystic Kidneys in a Young Patient: A Quiz

A rare case of concomitant hypophosphatemic osteomalacia and neurofibromatosis type 1

Abstract Introduction Neurofibromatosis type 1 is a rare genetic disorder with an increased susceptibility to develop skeletal abnormalities. However, the association of hypophosphatemic osteomalacia and neurofibromatosis type 1 is extremely rare. Herein, we report a case of hypophosphatemic osteomalacia in concomitant with neurofibromatosis type 1. Clinical Case A 45-year-old Turkish female patient, who was followed up in another hospital due to osteoporosis and kyphoscoliosis, applied to us with the complaints of persistent bone pain and inability to walk. She had no chronic diseases other than osteoporosis. The physical examination revealed widespread freckling over her trunk and proximal parts of upper and lower extremities and multiple neurofibromas and cafe au lait spots all over her body (figure 1). It was learned that her 2 brothers, mother and daughter also had the widespread freckling. They have no known chronic diseases. She had a severe degree of kyphoscoliosis. She had not have any complaints up to 24 years of age, and low back pain started after delivery. She was diagnosed with osteoporosis at the age of 29. In about 15 years, her height decreased from 167 cm to 135 cm. She had a severe degree of kyphoscoliosis and severe bone pain and was unable to walk on her own because of pain. Bilateral ophthalmic examination revealed no Lisch nodules. Audiometer revealed no abnormalities. Laboratory findings were as follows: Ca: 9.4 (8.4–10.6 mg/dl), phosphorus: 1.8 (2.3–4.7 mg/dl), albumin: 4.2 g/dl, parathormone: 88.3 (11–80 pg/ml), 25 hydroxy vitamin D: 26.1 ug/L, creatinine: 0.4 mg/dl, alkaline phosphatase: 79 (35–105 U/L), the 24-hour urinary excretion of calcium: 187.5 mg/24 h, the 24-hour urinary excretion of phosphorus: 253 mg/24 h, fractional excretion of phosphate: %8.5 and maximum transport of phosphorus in the renal proximal tubules (TmP/GFR): 0.74 (0.88–1.42 mmol/L). According to laboratory data there was a hyperphosphaturia. On the basis of the physical examination, laboratory and radiological findings, she was diagnosed with neurofibromatosis type 1 and hypophosphatemic osteomalacia. Oral phosphate solution (1.5 gram as elemantary phosphorus per day in 3 divided doses) and calcitriol (1 microgram per day in 2 divided doses) were started. After 6 months of therapy, bone pain was significantly decreased and her serum phosphorus level increased. The results of genetic analysis are awaited. Conclusion The coexistence of hypophosphatemic osteomalacia and neurofibromatosis type 1 have been reported in less than 50 cases in the literature. The underlying mechanism is not clarified. The diagnosis of hypophosphatemic osteomalacia should be kept in mind in patients with neurofibromatosis type 1, as they will benefit greatly from oral phosphorus solution and active vitamin D.

LBODP073 Non-functioning Pituitary Macroadenoma Presenting As Osteopenia In A Male

Abstract Non-functioning pituitary macroadenomas (NFPAs) account for 14-54% of all pituitary adenomas. NFPAs are benign, but mass effects may lead to significant symptoms, including visual impairment and pituitary insufficiency, of which secondary hypogonadism is present in 75% of reported cases. Patients with hypogonadism may experience decreased bone density, libido, muscle mass/strength, and fatigue. We describe a patient who presented with osteopenia, in addition to atypical symptoms of secondary hypogonadism, associated with low testosterone levels. Further workup disclosed a large pituitary macroadenoma. A 56-year-old male presented to the clinic for a two-year history of diffuse joint pain. X-rays were significant for bone loss. This led to a bone density scan that showed osteopenia with a T score of -2.3 in the lumbar spine and left femoral neck. He had no prior history of fractures or loss in height. Risk factors for bone disease were only pertinent for history of osteoporosis in his mother. He was referred to endocrinology for further evaluation. Work up included normal vitamin D levels, 24-hour urine calcium excretion, morning cortisol, and TSH. Given the patient's osteopenia and additional complaints of decreased appetite, weight loss, fatigue, and muscle weakness, testosterone levels were checked and found to be low. Free testosterone level was 14.3 pg/ml with inappropriately low FSH and LH. Prolactin was normal at 12.5 ng/ml. He subsequently had an MRI brain which revealed a pituitary macroadenoma measuring 2. 0×2.4×2.4 cm with mass effect on the optic chiasm. However, the patient did not complain of headaches or visual disturbances and visual field testing was normal. He underwent transsphenoidal resection of the pituitary tumor which led to normalization of testosterone levels and resolution of all his symptoms. This case exemplifies how non-specific symptoms of hypogonadism and absence of mass effect symptoms can lead to a delay in diagnosis of NFPA. Typically, NFPAs are detected when they are large enough to cause symptoms of mass effect which, interestingly, were absent in this patient despite compression of the optic chiasm. Male hypogonadism increases the risk for bone disease. Thus, it is important to pursue work up for secondary hypogonadism in males presenting with osteopenia/osteoporosis despite lack of overt symptoms. A thorough history and workup are essential in diagnosing NFPA. Prompt detection of NFPA can facilitate timely management leading to clinical improvement. The first line of treatment for NFPAs causing neurological symptoms is transsphenoidal surgical resection. Surgery is also recommended for NFPAs that are at high risk for causing visual deficits due to involvement of optic chiasm, as was seen in this patient. Post-surgical follow up includes long-term routine monitoring of hormone levels and neuroimaging. Presentation: No date and time listed

OR29-5 Phase 3 PaTHway Trial: Participants Treated With TransCon PTH Achieved Independence From Conventional Therapy While Maintaining Normal Serum Calcium

Abstract Background Adults with chronic hypoparathyroidism managed with conventional therapy (calcitriol, alfacalcidol, and oral calcium) generally report a reduced quality of life (QoL) and remain at risk for long-term complications from abnormal calcium and phosphate metabolism. The PaTHway trial assessed the efficacy and safety of TransCon PTH at Week 26. Methods PaTHway was a double-blind, placebo-controlled 26-week trial with 3: 1 randomization to TransCon PTH 18 mcg/d or placebo, co-administered with conventional therapy. The composite primary efficacy endpoint was the proportion of participants at Week 26 who achieved: serum calcium levels in the normal range (8.3–10.6 mg/dL), independence from conventional therapy defined as requiring no active vitamin D and ≤600 mg/day of calcium supplementation, and no increase in prescribed study drug over 4 weeks prior to Week 26. Key secondary endpoints included Hypoparathyroidism Patient Experience Scale (HPES) domain scores and 36-Item Short Form Survey (SF-36) subscale scores. Results 82 participants were dosed (78% female, mean age 49 years). 79 completed treatment through Week 26. 79% (48/61) of participants randomized to TransCon PTH met the composite primary efficacy endpoint, compared to 5% (1/21) in the placebo group (p &amp;lt;0.0001). 93% (57/61) participants treated with TransCon PTH achieved independence from conventional therapy. At baseline, mean serum calcium was 8.8 and 8.7 mg/dL for TransCon PTH and placebo respectively; 8.9 mg/dL and 8.2 mg/dL at Week 26, respectively. For TransCon PTH, mean urine calcium decreased significantly from 390 mg/24-hour at baseline to 220 mg/24-hour (normal range &amp;lt;250 mg/24-hour) at Week 26 compared to 329 mg/24-hour at baseline to 292 mg/24-hour at Week 26 for placebo. TransCon PTH therapy demonstrated a significant improvement in HPES-Symptom domain scores − Physical (p = 0.0038) and Cognitive (p = 0.0055), HPES-Impact domain scores − Physical Functioning (p = 0.0046) and Daily Life (p = 0.0061), and SF-36 Physical Functioning subscale score (p = 0.0347) compared to placebo. Overall, TransCon PTH was well-tolerated. The majority of adverse events (AE) were mild or moderate in severity. The most commonly reported study drug-related AEs were injection site reactions, hypercalcemia, and headaches. No study drug-related AEs led to withdrawal from the study. Conclusions In the PaTHway phase 3 trial, 79% of participants on TransCon PTH therapy (versus 5% on placebo) were able to achieve independence from conventional therapy while maintaining normocalcemia at Week 26. Uniquely, TransCon PTH therapy decreased and normalized 24-hour urine calcium excretion and significantly improved QoL (symptom burden and impact) from baseline compared to placebo. These data suggest the potential for TransCon PTH to improve clinical outcomes and QoL compared to current conventional therapy. Presentation: Tuesday, June 14, 2022 10:45 a.m. - 11:00 a.m.

ODP118 PTH (1-34) Replacement Therapy for Hypoparathyroidism due to Sporadic Calcium Sensing Receptor Gain-of-Function Point Mutation

Abstract Background The calcium sensing receptor (CASR) regulates parathyroid hormone secretion in response to extracellular calcium concentration. A gain-of-function mutation of the CASR lowers the set point for extracellular calcium sensing, resulting in both reduced parathyroid hormone secretion and increased urinary calcium excretion compared to other causes of hypoparathyroidism. Clinical Case After presenting with hypocalcemia-associated seizures at the age of two years, our patient had an undetectable serum parathyroid hormone level. He was started on calcitriol and calcium supplementation, however continued to have recurrent seizures throughout childhood. On ultrasound at age four, he exhibited nephrocalcinosis. DNA sequence analysis revealed a heterozygous T383G mutation nucleotide substitution on exon 3, resulting in the replacement of phenylalanine with cysteine at amino acid position 128. Our patient's base substitution likely represents a de novo mutation as we have confirmed that he has no family history of hypocalcemia. Notably, a different missense mutation at the same codon (F128L) co-segregated with autosomal dominant hypocalcemia in a large family, and functional studies confirm that mutation of this phenylalanine provides gain-of-function to the CASR. After enrolling in a clinical trial for continuous recombinant parathyroid hormone infusion at age seven, his symptoms of hypocalcemia abated. His seizures stopped, and anti-epileptic drugs were discontinued at age eight. After the clinical trial concluded, he was switched to teriparatide 10 micrograms three times daily, and serum calcium was maintained between 7.5 and 8.5 mg/dL. With the goal to minimize hypercalciuria and reduce the frequency of injections, teriparatide was discontinued, and recombinant parathyroid hormone (Natpara) 50 micrograms daily was started. This led to symptomatic hypocalcemia with muscle cramping and cognitive changes, and he was thus restarted on teriparatide with calcium carbonate supplementation. Despite maintenance of 24-hour urine calcium excretion ranging 325-388 mg, he developed bilateral flank pain. Computed tomography images revealed worsening nephrocalcinosis and bilateral nephrolithiasis. To reduce hypercalciuria and risk of stone formation, he was started on chlorthalidone, switched to calcium citrate, and encouraged to reduce dietary sodium intake. Conclusion This patient has a novel T383G activating mutation in CASR gene resulting in hypoparathyroidism and type 5 Bartter syndrome that has not been previously published in the literature. His hypocalcemia has remained stable on teriparatide for over 18 years, which to our knowledge, is the longest treatment duration using recombinant human parathyroid hormone for this purpose. We demonstrate a unique clinical challenge to balance treatment of hypoparathyroidism and hypocalcemia with teriparatide and supplemental calcium, while minimizing hypercalciuria and associated nephrocalcinosis. Presentation: No date and time listed

ODP075 A Rare Case of Intrathymic Parathyroid Adenoma

Abstract BACKGROUND: Parathyroid adenomas are the main cause of primary hyperparathyroidism (PHPT). PHPT most often affects adults between ages 50-60 and is considered rare in children and adolescents, representing less than 5% of cases1. It is more common among females than among males in the proportion 3 to 1. During embryogenesis, both the superior and inferior parathyroid glands detach from their pharyngeal origin and migrate towards their final location, posteriorly to the thyroid gland. Migration can be faulty and ectopic glands can appear along the path of embryologic descent2. We present a case of an adolescent male who presented with symptomatic PHPT in the setting of an intrathymic parathyroid adenoma. CASE PRESENTATION: 17-year-old male with no significant past medical history developed symptoms of anxiety, nausea and fatigue. Laboratory values revealed calcium 14.3 mg/dL (8.6-10.3), PTH 227 pg/mL (15-65), 25-dihydroxyvitamin D (vit-D) 8.31 ng/mL (30-100), and phosphorus 1.5 mg/dL (2.5-5. 0). He denied any personal history of bone fractures or nephrolithiasis. CT parathyroid scan showed an enhancing oblong 1.7×0.6 cm lesion in the left upper mediastinal space suggestive of a parathyroid adenoma. Focal sestamibi uptake confirmed a 1.7×0.6 cm enhancing nodule in the left upper anterior mediastinum within the thymus. He was instructed to take 2,000 IU of vit-D daily. Repeat blood work one month later showed that his serum calcium decreased to 13.4 mg/dL and PTH decreased to 122 pg/mL. Additional labs revealed vit-D 16.81 ng/mL, 1,25-dihydroxyvitamin D (calcitriol) 160 pg/mL (19.9-79.3) and 24-hour urine calcium excretion of 409 mg (0-320). Patient underwent successful excision of an intrathymic hyperplastic parathyroid gland adenoma with a &amp;gt;50% drop in peak PTH levels intraoperatively at 10 minutes post excision, later confirmed by pathology. CONCLUSION: This case highlights an adolescent with symptomatic primary hyperparathyroidism due to an intrathymic parathyroid adenoma. Ectopic adenomas have been reported in approximately 4 to 16% of patients with hyperparathyroidism2. When embryological development of the parathyroid glands is defective, it can predispose to the formation of ectopic glands, which is an important cause of failed parathyroid exploration. Unfortunately, PHPT has greater morbidity in the younger age group since most of these patients develop complications from the hypercalcemia, such as kidney stones, hypercalciuria, bone disease and symptoms of abdominal pain/vomiting. This case emphasizes the importance for clinicians to be aware of ectopic parathyroid adenoma in adolescents who present with symptoms and labs consistent with primary hyperparathyroidism.

Semptomatik veya asemptomatik primer hiperparatiroidisi olan hastaların biyokimyasal parametreleri ile CDKN1B mutasyon analizi tayini

Amaç: Bu çalışmada semptomatik ve asemptomatik primer hiperparatiroidi (PHPT) olgularını karşılaştırmayı amaçladık, beraberinde sporadik saptanan paratiroid adenomlarında etyopatogenezde CDKN1B mutasyonu varlılığını saptamaya çalıştık. &#x0D; Gereç ve Yöntem: Çalışmamıza kliniğimize başvuran 80 PHPT (66 K ve 14 E, ortalama yaş 50.8 ± 12.01 yıl) tanısı almış hasta dahil edilmiştir. Hastaların yaş, cinsiyet, biyokimyasal parametreleri, görüntüleme yöntemleri (nükleer sintigrafi, ultrasonografi, kemik dansitometre ölçümü) kayıt edilmiştir. CDKN1B gen sekanslaması için GeneMATRIX Quick Blood DNA Purification kiti kullanılarak DNA izole edilmiştir. CDKN1BF (rs786201010, c.-456_-453delCCTT) (CAGGTTTGTTGGCAGCAGTA) ve CDKN1BR (rs786201010, c.-456_-453delCCTT) (GGAGCCAAAAGACACAGACC) primerleri seçilerek mutasyon analizi yapılmıştır.&#x0D; Bulgular: Çalışma sonucunda 22 hasta asemptomatik PHPT olarak tanımlanmış olup semptomatik PHPT (n=68) serum kalsiyum parametreleri ve 24 saatlik idrar Ca+ atılımı daha yüksek olarak saptanmıştır. Serum Parathormon (PTH) değerleri her iki grupta da benzerdi. Her iki grupta da CDKN1B mutasyonu açısından patolojik bir bulgu saptanmamıştır.&#x0D; Sonuç: Parathormon seviyeleri semptomatik veya asemptomatik PHPT olgularında belirleyici bir parametre olmamakla birlikte semptomatik PHPT da serum kalsiyum değerleri ve 24 saatlik idrar Ca+ atılımı daha belirgindir.

Brachydactyly in Pseudopseudohypoparathyroidism

A 26-year-old woman was seen for a longstanding mild elevation of parathyroid hormone (PTH), with otherwise normal serum mineral levels. Repeat testing confirmed elevated PTH 75 pg/mL (15 to 65 pg/mL) with normal calcium 9.1 mg/dL (8.6 to 10.0 mg/dL), phosphorus 3.7 mg/dL (2.5 to 4.5 mg/dL), and creatinine 0.67 mg/dL (0.59 to 1.04 mg/dL). The results of 24-hour urine calcium excretion, thyroid stimulating hormone, and free thyroxine tests were normal. Total 25-hydroxy-vitamin D level was 18 ng/mL, indicating mild deficiency.

Effects of Calcium Source on Calcium-Metabolic Parameters in Healthy Women and Men

Background/Objectives: Calcium and vitamin D are important for bone health. We compared 24-hour urinary calcium-excretion (Uca/24hrs), during dietary calcium steady-state condition, for different calcium-sources and effects of vitamin D, age and sex. Subjects/Methods: Fifty-two healthy pre- and postmenopausal women and men completed the regimens: placebo, calcium carbonate (400mg) +18μg vitamin D, calcium carbonate (400mg) +38μg vitamin D and 400mg calcium phosphate (milk). Uca/24hrs was measured during dietary calcium steady state as a surrogate measure of calcium-absorption. Serum-calcium, parathyroid hormone (PTH), 25-hydroxy-vitamin D, Procollagen Type 1 N-terminal Pro- Peptide (P1NP) and C-terminal Telopeptide of type 1 collagen (CTX) were measured. Results: Mean daily intake of calcium for the study group ± SD was 1105 ±396 mg. Mean-Uca ± SD: placebo 5.19 ± 2.04 mmol/24hrs, milk 5.88 ± 2.39 mmol/24hrs, (CaCO3+D) 6.19 ± 2.34 mmol/24hrs and (CaCO3 + DD) 6.26 ± 2.32 mmol/day. Uca were higher for all regimens compared to placebo (p &lt;0.001), no difference was found between regimens. CTX was lower during all regimens compared to placebo (p &lt;0.001): placebo 450 ± 243 μg/L, Milk 377 ± 248 μg/L, (CaCO3+D) 392 ± 266 μg/L and (CaCO3+DD) 361 ± 232 μg/L. Conclusions: Uca was higher during supplementation with calcium compared to placebo. Supplementation with calcium reduced bone resorption significantly without effecting PTH. Menopausal status, sex and supplement with vitamin d demonstrated no effect on calcium excretion.

MO1004IMBALANCE IN URINARY PROTEOGLYCANS AND THE INSULIN GROWTH FACTOR (IGF) AXIS IN CHILDREN WITH NEPHROLITHIASIS*

Abstract Background and Aims In vitro experiments have shown that exposure of renal epithelial cells to calcium oxalate crystals leads to synthesis of proteins involved in extracellular matrix (ECM) production. Cell proliferation and accumulation of ECM proteins have been reported in animal models and kidney biopsies from patients with stones. Based on the role of ECM in the Randall plaque formation, we aimed to identify and quantify ECM proteins in the urine of children with nephrolithiasis (RS) using a proteomic approach. Method Prospective, controlled, pilot study of pooled urine from RS (N=30, 24 females, mean age 12.95±4.03 years) versus age- and gender-matched healthy controls (HC), using liquid chromatography-mass spectrometry (LC-MS/MS). Patient inclusion criteria consisted of age 5-18 years, history of clinically (typical renal colic) and radiographically (ultrasound or CT) proven renal stone, at least two 24-hour satisfactory urine collections (urinary creatinine more than 15 mg/kg/day), absence of hematuria or pyuria, and normal renal function. Children who were not toilet trained, or those with bladder stones, nephrocalcinosis, neuropathic bladder, major congenital bladder abnormality, active urinary tract infection, presence of blood in urine, chronic kidney disease, previous major reconstructive bladder surgery requiring catheterization, and significant cardiac, pulmonary, gastro-intestinal, and neurological problems were excluded. Relative protein abundance was estimated using spectral counting. The criteria for protein selection were: 1) patient/control abundance ratios of &amp;gt;5 or &amp;lt;0.2 as a threshold to be well above observed technical variations in MS experiments; and 2) ≤0.05 p-value for the Fisher’s Exact Test. Results were confirmed by ELISA testing. Statistical analyses were conducted with IBM SPSS® version 20. Results We found 36 (15.7%) ECM proteins out of 229 proteins that met the above criteria. Significant differences between RS and HC were found among two proteoglycans and four insulin growth factor (IGF) proteins (Table). Significant increase in the urinary excretion of IGFBP4 in RS (37.00 ± 37.68 ng/mg creatinine ) versus HC (19.04 ± 20.32 ng/mg creatinine) was confirmed by ELISA (p=0.049). Statistically significant correlation was found between urinary IGFBP4 concentration and 24-hour urinary calcium excretion (p&amp;lt;0.001). Conclusion Alteration in proteoglycans and the IGF axis appears to have a significant role in the mechanism of nephrolithiasis, likely by modulating ECM biosynthesis. Further understanding of their roles in nephrolithiasis may aid in generation of novel therapeutic approaches.

Radiotherapy-Associated Pelvic Insufficiency Fracture Treated by Romosozumab: Course of L1 and L5 Vertebral Body CT Attenuation

Background: Radiotherapy is a risk factor for osteoporosis and insufficiency fractures via osteoblast apoptosis and vascular injury. PTH analogs teriparatide and abaloparatide are contraindicated in patients with prior exposure to radiotherapy crossing bone due to the increased risk of osteosarcoma. Patients with radiotherapy-associated fractures or osteoporosis were eligible only for antiresorptive agents until romosozumab was recently FDA-approved. Current International Society for Clinical Densitometry (ISCD) guidelines include assessment of “opportunistic CT” as a surrogate for DXA scan using L1 vertebral body attenuation: >150 Hounsfield units (HU) is normal and <100 HU signifies osteoporosis.Clinical Case: A 60 year old female patient with history of endometrial cancer diagnosed at age of 57 and treated with hysterectomy and bilateral salpingo-oophorectomy, chemotherapy, then pelvic radiotherapy, was referred to endocrinology for pelvic insufficiency fractures evaluation. Two years after completing chemoradiotherapy, she complained of right groin and low back pain with difficulty walking. MRI pelvis showed bilateral sacral ala and right pubic ramus insufficiency fractures. She had normal serum mineral concentration, 25-OH vitamin D sufficiency, normal PTH, eGFR, liver function tests and 24-hour urine calcium excretion. Screening for celiac disease and multiple myeloma was negative. DXA scan BMD T-score showed osteoporosis, -3.0 at the right femoral neck. L1-L4 T-score was +0.4 but unreliable due to presence of degenerative changes. Four months after onset of pain, patient started romosozumab 210mg SQ monthly for a total of 12 doses, after which she started oral alendronate. Pain essentially resolved within 6 months of romosozumab therapy. C-telopeptide (CTX) and procollagen type 1 N-terminal propeptide (P1NP) were obtained at baseline, 3 and 12 months after romosozumab initiation. CTX was 362, 247 and 258 pg/mL (reference range, >49 years: not established), and P1NP was 82, 178 and 62 mcg/L (reference range, 20 - 108), respectively. Attenuation of L1 and L5 vertebral body was measured using CT abdomen and pelvis scans before and 5 months after radiotherapy, and before and after completion of romosozumab therapy. L1 attenuation measured 161, 132, 127 and 179 HU, and L5 measured 150, 46, 50 and 86 HU, respectively.Conclusion: Pelvic radiotherapy was associated with a decline in L1 CT attenuation and even greater magnitude of decrease at L5. Romosozumab was associated with clinical improvement, restoration of L1 CT attenuation and diminishment of regain at L5. Although L5 attenuation has not been previously assessed for osteoporosis, this site may be of predictive value in patients who receive pelvic radiotherapy.

Nutritional status assessed by the Controlling Nutritional Status (CONUT) score as a predictor of recurrence of urolithiasis.

PurposeWe aimed to determine the influence of nutritional status on urinary metabolic abnormalities and stone recurrence in patients with urolithiasis.Materials and MethodsWe analyzed data for 464 stone-formers and 464 propensity-score-matched control patients that had been collected between 2003 and 2015. Nutritional status was evaluated by use of the Controlling Nutritional Status (CONUT) score, and patients were placed into two CONUT score categories (0–1 and ≥2). Serum and 24-hour urinary metabolites were evaluated in 464 stone-formers. Kaplan–Meier and multivariate Cox regression analyses were performed to assess the influence of nutritional status on stone recurrence. Stone recurrence was defined as radiographic appearance of new stones during the follow-up period.ResultsStone-formers showed a higher prevalence of poor nutrition (CONUT score ≥2) than did the propensity-score-matched control patients (p<0.001). Stone-formers who had poor nutritional status had significantly lower 24-hour urinary calcium but higher oxalate excretion (each p<0.05). Kaplan–Meier estimates demonstrated that stone-formers with poor nutritional status also experienced stone recurrence more rapidly (log-rank test, p=0.014). Multivariate Cox regression revealed that poor nutritional status was independently associated with stone recurrence (hazard ratio, 1.736; 95% confidence interval, 1.041–2.896; p=0.034).ConclusionsThe CONUT score, an easily measured immunonutritional biomarker, is independently associated with a higher risk for stone recurrence in patients with urolithiasis. This implies that not only dietary excess, but also undernourished status, may be associated with aberrations in urine physicochemistry and stone recurrence.

Urinary calcium indices in primary hyperparathyroidism (PHPT) and familial hypocalciuric hypercalcaemia (FHH): which test performs best?

AimPrimary hyperparathyroidism (PHPT) is much more common than familial hypocalciuric hypercalcaemia (FHH), but there is considerable overlap in biochemical features. Urine calcium indices help with the differential diagnosis, but their...

Relationship between bone markers and cardiovascular risk factors in healthy Nigerian adults

Background: Osteoporosis and cardiovascular diseases are global public health concerns. Both diseases have been linked through common risk factors and biological mechanisms. Objective: To evaluate the association between bone turnover markers (BTM) and some cardiovascular risk factors among healthy Nigerian adults. Methods: This was a cross-sectional, observational study of 80 healthy participants of less than 50 years of age. Clinical data were obtained through an interviewer-based questionnaire. Fasting blood samples were analysed for Osteocalcin (OC), Total Alkaline phosphatase (ALP), 25-hydroxyvitamin D (25-OHVitD), Calcium (Ca), Fasting Blood Glucose (FBG). Two-hour postprandial blood glucose (2HPP) Calcium-phosphorus product calculated (CAP) and 24-hour urinary calcium excretion (CaE) were determined. Results: The mean age of the participants was 32.1±5.8 years, mean BMI was 26.3±4.0kg/m2 and the mean waist circumference (WC) was 79.6±16.0cm. OC was directly correlated with ALP (r = 0.4, p = 0.006) but not with CaE (p = 0.8). Serum OC was inversely correlated with age, BMI and WC. ALP was negatively correlated with FBG (r = - 0.3, p = 0.04), 2HPP (r = - 0.65, p = 0.000). Multivariate regression showed that BTMs-OC, ALP and CAE independently predicted BMI, 2HPP, DBP and FBG respectively. Conclusion: This study showed a relationship between bone markers and selected cardiovascular risk factors in Nigerian adults. Therefore, patients with cardiovascular disease may benefit from bone health screening or vice versa.