24-hour Calcium Excretion Research Articles

Semptomatik veya asemptomatik primer hiperparatiroidisi olan hastaların biyokimyasal parametreleri ile CDKN1B mutasyon analizi tayini

Amaç: Bu çalışmada semptomatik ve asemptomatik primer hiperparatiroidi (PHPT) olgularını karşılaştırmayı amaçladık, beraberinde sporadik saptanan paratiroid adenomlarında etyopatogenezde CDKN1B mutasyonu varlılığını saptamaya çalıştık. 
 Gereç ve Yöntem: Çalışmamıza kliniğimize başvuran 80 PHPT (66 K ve 14 E, ortalama yaş 50.8 ± 12.01 yıl) tanısı almış hasta dahil edilmiştir. Hastaların yaş, cinsiyet, biyokimyasal parametreleri, görüntüleme yöntemleri (nükleer sintigrafi, ultrasonografi, kemik dansitometre ölçümü) kayıt edilmiştir. CDKN1B gen sekanslaması için GeneMATRIX Quick Blood DNA Purification kiti kullanılarak DNA izole edilmiştir. CDKN1BF (rs786201010, c.-456_-453delCCTT) (CAGGTTTGTTGGCAGCAGTA) ve CDKN1BR (rs786201010, c.-456_-453delCCTT) (GGAGCCAAAAGACACAGACC) primerleri seçilerek mutasyon analizi yapılmıştır.
 Bulgular: Çalışma sonucunda 22 hasta asemptomatik PHPT olarak tanımlanmış olup semptomatik PHPT (n=68) serum kalsiyum parametreleri ve 24 saatlik idrar Ca+ atılımı daha yüksek olarak saptanmıştır. Serum Parathormon (PTH) değerleri her iki grupta da benzerdi. Her iki grupta da CDKN1B mutasyonu açısından patolojik bir bulgu saptanmamıştır.
 Sonuç: Parathormon seviyeleri semptomatik veya asemptomatik PHPT olgularında belirleyici bir parametre olmamakla birlikte semptomatik PHPT da serum kalsiyum değerleri ve 24 saatlik idrar Ca+ atılımı daha belirgindir.

Claudin-14 Gene Polymorphisms and Urine Calcium Excretion.

Claudin-16 and -19 are proteins forming pores for the paracellular reabsorption of divalent cations in the ascending limb of Henle loop; conversely, claudin-14 decreases ion permeability of these pores. Single-nucleotide polymorphisms in gene coding for claudin-14 were associated with kidney stones and calcium excretion. This study aimed to explore the association of claudin-14, claudin-16, and claudin-19 single-nucleotide polymorphisms with calcium excretion. We performed a retrospective observational study of 393 patients with hypertension who were naïve to antihypertensive drugs, in whom we measured 24-hour urine calcium excretion; history of kidney stones was ascertained by interview; 370 of these patients underwent an intravenous 0.9% sodium chloride infusion (2 L in 2 hours) to evaluate the response of calcium excretion in three different 2-hour urine samples collected before, during, and after saline infusion. Genotypes of claudin-14, claudin-16, and claudin-19 were obtained from data of a previous genome-wide association study in the same patients. Thirty-one single-nucleotide polymorphisms of the 3' region of the claudin-14 gene were significantly associated with 24-hour calcium excretion and calcium excretion after saline infusion. The most significant associated single-nucleotide polymorphism was rs219755 (24-hour calcium excretion in GG, 225±124 mg/24 hours; 24-hour calcium excretion in GA, 194±100 mg/24 hours; 24-hour calcium excretion in AA, 124±73 mg/24 hours; P<0.001; calcium excretion during saline infusion in GG, 30±21 mg/2 hours; calcium excretion during saline infusion in GA, 29±18 mg/2 hours; calcium excretion during saline infusion in AA, 17±11 mg/2 hours; P=0.03). No significant associations were found among claudin-16 and claudin-19 single-nucleotide polymorphisms and calcium excretion and between claudin-14, claudin-16, and claudin-19 single-nucleotide polymorphisms and stones. Bioinformatic analysis showed that one single-nucleotide polymorphism at claudin-14 among those associated with calcium excretion may potentially influence splicing of transcript. Claudin-14 genotype at the 3' region is associated with calcium excretion in 24-hour urine and after the calciuretic stimulus of saline infusion.

Predictors of Renal Function and Calcifications in Primary Hyperparathyroidism: A Nested Case-Control Study.

Some patients with primary hyperparathyroidism (PHPT) develop renal calcifications. Investigation of urinary and nonurinary risk factors are essential. We aimed to study the prevalence and potential biochemical predictors of renal calcifications. Nested case-control study. University hospital. We identified 792 patients with PHPT from 2005 to 2015. We used biochemical data to validate the diagnosis of PHPT. The prevalence of renal calcifications defined as nephrolithiasis or nephrocalcinosis assessed by a routine CT scan at the time of diagnosis. A total of 792 patients with PHPT were identified among whom 617 patients (78%) had a CT scan preformed. We found a prevalence of renal calcifications of 23%, equally frequent between sexes. A total of 76 patients (12%) had nephrolithiasis and 75 patients (12%) had nephrocalcinosis where 7 patients (1%) had both nephrolithiasis and nephrocalcinosis. Compared with patients without renal calcifications, patients with renal calcifications had significantly higher levels of ionized calcium, parathyroid hormone, and 24-hour calcium excretion (Pall < 0.01). Patients with nephrocalcinosis had higher plasma levels of phosphate and a higher calcium-phosphate product compared with patients with nephrolithiasis (Pall < 0.05). Impaired renal function (estimated glomerular filtration rate <60 mL/min) was observed in 12% of patients. However, no differences in renal function were observed between those with and without renal calcifications. Renal calcifications are frequent in patients with PHPT and are associated with the severity of the disease. Impaired renal function is also common in PHPT, but renal function was not associated with renal calcifications.

Furosemide Increases the Risk of Hyperparathyroidism in Chronic Kidney Disease

Background: Diuretics are widely used in patients with chronic kidney disease (CKD). While thiazide-like diuretics limit urinary calcium excretion, loop diuretics (LD) promote calcium wasting, which might facilitate the development of secondary hyperparathyroidism (HPT2). We sought to investigate, in CKD patients not on dialysis, the influence of either hydrochlorothiazide (Hydro) or furosemide (Furo) on circulating parathyroid hormone (PTH) and whether such actions are determined by the effects of these compounds on calcium excretion. Methods: Electronic charts of all nephrology outpatients (CKD stages 2-5) who were given Hydro or Furo were included. We assessed estimated glomerular filtration rate (eGFR), biochemical parameters and 24-hour calcium excretion. Hyperparathyroidism was defined as PTH >65 pg/ml. Results: Out of 275 patients, 108 (29%) were taking Hydro and 167 (61%) Furo. Patients on Hydro were younger, mostly female and had higher eGFR. The median 24-hour urinary calcium excretion in the overall cohort was 41 (22, 76), being lower in Furo than in Hydro patients (37 (16, 68) vs. 47 (26, 88) mg/24 h, respectively, p = 0.016). Logistic regression showed that, after adjustment for eGFR, calcium excretion rate was found not to increase the risk ratio for HPT2, whereas Furo was a strong predictor of HPT2. Conclusion: Furo increased the risk of HPT2 among CKD patients compared to Hydro. This effect was independent of eGFR or calcium excretion. The use of LD in CKD, currently preferred in advanced stages, should be reappraised.

Pharmacokinetics and Pharmacodynamics of Subcutaneous Recombinant Parathyroid Hormone (1–84) in Patients With Hypoparathyroidism: An Open-Label, Single-Dose, Phase I Study

BackgroundImpaired mineral homeostasis affecting calcium, phosphate, and magnesium is a result of parathyroid hormone (PTH) deficiency in hypoparathyroidism. The current standard of treatment with active vitamin D and oral calcium does not control levels of these major minerals. Recombinant full-length human PTH 1–84 (rhPTH[1–84]) is being developed for the treatment of hypoparathyroidism. ObjectiveThe goal of this study was to investigate the pharmacokinetics and pharmacodynamics of a single subcutaneous injection of rhPTH(1–84) in patients with hypoparathyroidism. MethodsThis was an open-label, dose-escalating study of single subcutaneous administration of 50 µg and then 100 µg of rhPTH(1–84). Enrolled patients (age range, 25–85 years) had ≥12 months of diagnosed hypoparathyroidism defined according to biochemical evidence of hypocalcemia with concomitant low-serum intact PTH and were taking doses ≥1000 mg/d of oral calcium and ≥0.25 µg/d of active vitamin D (oral calcitriol). The patient’s prescribed dose of calcitriol was taken the day preceding but not on the day of or during the 24 hours after rhPTH(1–84) administration. Each patient received a single 50-µg rhPTH(1–84) dose, had at least a 7-day washout interval, and then received a single 100-µg rhPTH(1–84) dose. The following parameters were assessed: plasma PTH; serum and urine total calcium, magnesium, phosphate, and creatinine; and urine cyclic adenosine monophosphate. ResultsAfter administration of rhPTH(1–84) 50 µg (n = 6) and 100 µg (n = 7), the approximate t½ was 2.5 to 3 hours. Plasma PTH levels increased rapidly, then declined gradually back to predose levels at ~12 hours. The median AUC was similar with calcitriol and rhPTH(1–84) for serum 1,25-dihydroxyvitamin D (calcitriol, 123–227 pg · h/mL; rhPTH[1–84], 101–276 pg · h/mL), calcium (calcitriol, 3.3–3.7 mg · h/dL; rhPTH[1–84], 3.3–7.6 mg · h/dL), and magnesium (calcitriol, 0.7–0.9 mg · h/dL; rhPTH[1–84], 1.3–2.8 mg · h/dL). In contrast, the median AUC for phosphate was strongly negative with rhPTH(1–84) (calcitriol, −1.0 to 0.8 mg · h/dL; rhPTH[1–84], −21.3 to −26.5 mg · h/dL). Compared with calcitriol, rhPTH(1–84) 50 µg reduced 24-hour calcium excretion and calcium-to-creatinine ratios by 12% and 23%, respectively, and rhPTH(1–84) 100 µg reduced them by 26% and 27%. There was little overall impact on urine magnesium levels. Compared with calcitriol, rhPTH(1–84) 50 µg increased urinary phosphate excretion and phosphate-to-creatinine ratios by 53% and 54%, respectively, and rhPTH(1–84) 100 µg increased them by 45% and 42%. Urine cyclic adenosine monophosphate–to–creatinine ratio increased with rhPTH(1–84) by 2.3-fold (50 µg) and 4.4-fold (100 µg) compared with calcitriol. ConclusionsPTH replacement therapy with rhPTH(1–84) regulated mineral homeostasis of calcium, magnesium, phosphate, and vitamin D metabolism toward normal in these study patients with hypoparathyroidism.

Letter by Tsuda Regarding Article, “Vitamin D Deficiency Is Associated With Subclinical Carotid Atherosclerosis: The Northern Manhattan Study”

HomeStrokeVol. 42, No. 12Letter by Tsuda Regarding Article, “Vitamin D Deficiency Is Associated With Subclinical Carotid Atherosclerosis: The Northern Manhattan Study” Free AccessLetterPDF/EPUBAboutView PDFView EPUBSections ToolsAdd to favoritesDownload citationsTrack citationsPermissions ShareShare onFacebookTwitterLinked InMendeleyReddit Jump toFree AccessLetterPDF/EPUBLetter by Tsuda Regarding Article, “Vitamin D Deficiency Is Associated With Subclinical Carotid Atherosclerosis: The Northern Manhattan Study” Kazushi Tsuda, MD, FAHA Kazushi TsudaKazushi Tsuda Cardiovascular and Metabolic Research Center Kansai University of Health Sciences Osaka, Japan (Tsuda) Search for more papers by this author Originally published27 Oct 2011https://doi.org/10.1161/STROKEAHA.111.634154Stroke. 2011;42:e639Other version(s) of this articleYou are viewing the most recent version of this article. Previous versions: January 1, 2011: Previous Version 1 To the Editor:We read with great interest the article by Carrelli et al1 dealing with the relationship between serum vitamin D levels and carotid atherosclerosis in a free-living, stroke-free, multiethnic, urban cohort. The results of their study demonstrated that serum phosphorus and calcium–phosphorus product were associated with a greater burden of subclinical carotid atherosclerosis. Among those with carotid plaque, the authors found that lower 25-hydroxyvitamin D levels were associated with thicker plaque and higher intima-media thickness of the carotid artery. The authors proposed the strong relationship between vitamin D deficiency and carotid vascular abnormalities that predicts the development of myocardial infarction and stroke.Evidence indicates that there were significant associations between low bone mineral density (BMD) and stroke. Jörgensen et al2 proposed that low BMD might predict first stroke in women. In a study we presented previously, a relationship between BMD and hypertension was investigated in women. Using the dual-energy X-ray absorptiometric method, we demonstrated that BMD in lumbar spine was significantly decreased in elderly hypertensive women compared with elderly normotensive women.3 In addition, BMD was inversely correlated with systolic blood pressure, suggesting that high blood pressure might be associated with the decrease in BMD in elderly women. Several studies have shown that hypertension is related to abnormalities of the calcium metabolism, such as increased calcium losses from the kidney, secondary activation of parathyroid glands, and vitamin D deficiency. It was demonstrated that the greater the 24-hour calcium excretion was, the lower the BMD was in women.3 It was also shown that BMD correlated negatively with serum vitamin D levels in elderly poststroke patients.4 Recently, Pilz et al5 demonstrated that low levels of 25-hydroxyvitamin D and 1, 25-hydroxyvitamin D were independent determinants of fatal stroke and were reduced in patients with a history of previous cerebrovascular diseases. Furthermore, they proposed that vitamin D supplementation might be a promising approach in the prevention of stroke.In this context, it can be speculated that in subjects with hypertension and lowered BMD, the disturbances in the calcium metabolism might be more pronounced. Therefore, we would like to know whether serum vitamin D levels might be related to the magnitudes of blood pressure or BMD in the populations in the study of Carrelli et al. It would be important to assess more precisely the relationships among vitamin D deficiency, BMD losses, and hypertension, and their contribution to stroke incidence.Kazushi Tsuda, MD, FAHA Cardiovascular and Metabolic Research Center Kansai University of Health Sciences Osaka, JapanDisclosuresNone.FootnotesStroke welcomes Letters to the Editor and will publish them, if suitable, as space permits. Letters must reference a Stroke published-ahead-of-print article or an article printed within the past 3 weeks. The maximum length is 750 words including no more than 5 references and 3 authors. Please submit letters typed double-spaced. Letters may be shortened or edited. Include a completed copyright transfer agreement form (available online at http://stroke.ahajournals.org and http://submit-stroke.ahajournals.org).

Relation of urinary calcium and magnesium excretion to blood pressure: The International Study Of Macro- And Micro-nutrients And Blood Pressure and The International Cooperative Study On Salt, Other Factors, And Blood Pressure.

Data indicate an inverse association between dietary calcium and magnesium intakes and blood pressure (BP); however, much less is known about associations between urinary calcium and magnesium excretion and BP in general populations. The authors assessed the relation of BP to 24-hour excretion of calcium and magnesium in 2 cross-sectional studies. The International Study of Macro- and Micro-Nutrients and Blood Pressure (INTERMAP) comprised 4,679 persons aged 40-59 years from 17 population samples in China, Japan, the United Kingdom, and the United States, and the International Cooperative Study on Salt, Other Factors, and Blood Pressure (INTERSALT) comprised 10,067 persons aged 20-59 years from 52 samples around the world. Timed 24-hour urine collections, BP measurements, and nutrient data from four 24-hour dietary recalls (INTERMAP) were collected. In multiple linear regression analyses, urinary calcium excretion was directly associated with BP. After adjustment for multiple confounders (including weight, height, alcohol intake, calcium intake, urinary sodium level, and urinary potassium intake), systolic BP was 1.9 mm Hg higher per each 4.1 mmol per 24 hours (2 standard deviations) of higher urinary calcium excretion (associations were smaller for diastolic BP) in INTERMAP. Qualitatively similar associations were observed in INTERSALT analyses. Associations between magnesium excretion and BP were small and nonsignificant for most of the models examined. The present data suggest that altered calcium homoeostasis, as exhibited by increased calcium excretion, is associated with higher BP levels.

Sustained increase in bone mineral density with alendronate in combination with indapamide in postmenopausal women with idiopathic hypercalciuria associated to osteoporosis: A 1-year randomized trial followed by a 2-year extension

Sustained increase in bone mineral density with alendronate in combination with indapamide in postmenopausal women with idiopathic hypercalciuria associated to osteoporosis: A 1-year randomized trial followed by a 2-year extension

Addition of Inulin to Breakfast Does Not Acutely Affect Serum Ionized Calcium and Parathyroid Hormone Concentrations

Background/Aims: The aim of the present study was to investigate the effects of inulin on calcium metabolism. The study consisted of two separate parts both of which had a randomized two-period cross-over design. Methods: Fifteen young healthy women volunteered to participate in this study. During the first part of the study, cheese containing 210 mg of calcium, either with 15 g of inulin or without any inulin, was ingested at breakfast, and in the second part, 210 mg of calcium as a supplement, either with 15 g inulin or without inulin, was ingested. The whole day’s diet was standardized. Before breakfast, and 2, 4, 6 and 8 h after breakfast, a blood sample was taken, and intact parathyroid hormone (iPTH), ionized calcium (iCa) and total calcium were measured. Urine was collected throughout the day, and the 8-, 12- and 24-hour calcium excretion was calculated. Results: The iPTH or iCa concentration curves (AUCs) did not differ over 8 h, whether or not inulin was consumed at breakfast. The postload urinary calcium excretion was not affected by the inulin. Conclusion: Fifteen grams of inulin in fresh cheese or with a calcium supplement (210 mg Ca) taken at breakfast does not acutely affect the markers of calcium metabolism as opposed to a corresponding breakfast without inulin.

Urine calcium excretion, nephrogenous cyclic-adenosine monophosphate and serum parathyroid hormone levels in patients with essential hypertension.

To evaluate the role of calcium and the parathyroid gland in the pathophysiology of essential hypertension, creatinine clearance, urinary excretion of sodium, calcium and nephrogenous cyclic adenosine monophosphate (NcAMP) and serum parathyroid hormone (PTH) levels were measured in 25 newly diagnosed essentially hypertensive patients before institution of any treatment and in 25 age- and sex-matched normal volunteers. While no significant differences in creatinine clearance, serum total calcium levels or 24-hour sodium excretion existed between the two groups, hypertensives had a higher mean (+/- SD) 24-hour calcium excretion rate (199.0 +/- 44.7 vs. 152.8 +/- 33.6 mg, p less than 0.001), a higher mean NcAMP excretion rate (2.54 +/- 0.8 vs. 1.87 +/- 0.5 nmol/100 ml glomerular filtrate, p less than 0.001) and a higher mean serum PTH concentration (1.87 +/- 0.6 vs. 1.53 +/- 0.4 ng/ml, p less than 0.001) than the normotensives. A significant positive correlation existed between calcium and sodium excretion in both hypertensives (r = 0.66, p less than 0.001)) and normotensives (r = 0.67, p less than 0.001), but given the same levels of creatinine clearance and sodium excretion, hypertensives excreted more calcium than normotensives (p less than 0.001)). In both hypertensives and normotensives, serum PTH levels were positively correlated with NcAMP excretion (r = 0.42, p less than 0.05, and r = 0.41, p less than 0.05, respectively) and the ratio of urinary sodium to urinary calcium excretion (r = 0.59, p less than 0.001, and r = 0.75, p less than 0.001), respectively). The above results suggest that in essential hypertension, increased activity of parathyroid glands may occur as a consequence of increased urinary calcium losses which are presumably due to an intrinsic defect in renal calcium handling.

Hypocalciuria in hypertensive disorder in pregnancy and how to measure it

We studied the urinary calcium excretion in 41 patients in the third trimester of pregnancy. There was a significant decrease in 24-hour calcium excretion in hypertensive and pre-eclamptic patients. The 24-hour calcium excretion correlated well with the calcium to creatinine ratio of a single voided urine sample. We conclude that measuring urinary calcium excretion may be valuable in the care and the study of pregnant patients with hypertensive disorders, and that the 24-hour urinary calcium excretion can be estimated from a single voided urine sample.

Sensitivity of the parathyroid hormone-1,25-dihydroxyvitamin D axis to variations in calcium intake in patients with primary hyperparathyroidism.

Previous studies have demonstrated a spectrum of parathyroid responsivity to alterations in the extracellular calcium concentration in patients with primary hyperparathyroidism, but studies employing physiologic amounts of calcium have not, to our knowledge, been reported. We studied 18 unselected patients with primary hyperparathyroidism at the lower (400 mg) and upper (1000 mg) limits of a normal dietary intake of calcium. The diet containing high-normal amounts of calcium induced only a slight increase in 24-hour calcium excretion (from 281 to 337 mg per day) yet was associated with significant reductions in fasting serum levels of immunoreactive parathyroid hormone (from 60 to 50 nleq per milliliter; P less than 0.001), nephrogenous cyclic AMP (from 3.52 to 2.63 nmol per deciliter of glomerular filtrate; P less than 0.001), and plasma levels of 1,25-dihydroxyvitamin D (from 74 to 58 pg per milliliter; P less than 0.001). A wide spectrum of responses was observed, with some patients appearing to have essentially autonomous parathyroid function and others having marked suppressibility (up to 50 per cent) of the parathyroid hormone-vitamin D axis. We conclude that parathyroid function may be suppressed by dietary calcium in some patients with primary hyperparathyroidism.

Calcium homeostasis in immobilization: an example of resorptive hypercalciuria.

Prolonged immobilization may result in hypercalcemia, hypercalciuria, and osteoporosis. Although bone resorption is central to this syndrome, the mechanism of resorption is uncertain. In particular, the role of systemic calcium-regulating hormones remains unclear. In 14 immobilized subjects we measured fasting calcium excretion, 24-hour urinary calcium excretion during restricted calcium intake, the renal phosphorus threshold, plasma 1,25-dihydroxyvitamin D, nephrogenous cyclic AMP, and immunoreactive parathyroid hormone. Mean serum calcium levels were normal, but fasting and 24-hour calcium excretion were markedly elevated (0.28 mg per deciliter of glomerular filtrate and 314 mg per 24 hours, respectively). The mean levels of serum phosphorus (4.8 mg per deciliter) and the renal phosphorus threshold (4.3 mg per deciliter) were elevated. Mean plasma 1,25-dihydroxyvitamin D was strikingly reduced (9.9 pg per milliliter), as were nephrogenous cyclic (0.64 nmol per deciliter of glomerular filtrate) and immunoreactive parathyroid hormone in both assays. These findings indicate that the parathyroid--1,25-dihydroxyvitamin D axis is suppressed in patients with immobilization-induced hypercalciuria, as would be predicted by a model of resorptive hypercalciuria.

Treatment of hypoparathyroid patients with chlorthalidone.

In an effort to maintain normal serum calcium levels without inducing hypercalciuria, we treated seven hypoparathyroid patients for up to 25 months with chlorthalidone, a thiazide-like sulfonamide diuretic, plus a salt-restricted diet, without added vitamin D. Mean 24-hour calcium excretion decreased from 179 to 88 mg (P less than 0.001), and mean serum calcium increased from 8.2 to 9.3 mg per deciliter (P less than 0.05). Diuretic therapy or moderate salt restriction alone was not as effective as combined therapy. Beneficial effects were sustained for as long as therapy was maintained. The rise in serum calcium, which involves the filterable and ionized fractions, cannot be due entirely to reduced excretion and may in part be explained by increased intestinal absorption. Oral chlorthalidone plus a low salt diet appears to be an effective alternative to vitamin D in the maintenance therapy of at least some patients with hypoparathyroidism.

PRESENCE OR ABSENCE OF INHIBITOR OF CALCIUM-OXALATE CRYSTAL GROWTH IN URINE OF NORMALS AND OF STONE-FORMERS

Normal urine contains an inhibitor of calcium-oxalate crystal growth, and the crystals which first form on a glass fibre when the urine is slowly saturated with calcium and oxalate ions at pH 5·5-6·2 are usually of its monohydrate. The same is found when the urine is from a normal subject who has hypercalcuria, or from certain patients with hypercalcuria of various origins and with no renal stones. Urine from patients who have formed calcium-containing stones have less inhibitor and usually crystallise calcium oxalate dihydrate first. This occurs whether or not the patients have hypercalcuria. The presence or absence of inhibitor and the crystal structure of the early precipitate therefore both correlate much better with the tendency to form stones than does any currently measured factor such as the 24-hour excretion of calcium. In patients with the various clinical forms of primary hyperparathyroidism, and perhaps also in cystinurics, there is a similar possible relationship between the tendency to form urinary stones and the amount of inhibitor present and the hydration of the induced calcium-oxalate precipitate. Hyperuricæmia, often with clinical gout, occurs too frequently among severe idiopathic hypercalcurics to be a chance occurrence.

URINARY EXCRETION OF CALCIUM AND MAGNESIUM IN PATIENTS WITH CALCIUM-CONTAINING RENAL STONES

The 24-hour excretion of calcium and Summary magnesium were determined in the urine of fifty-four male patients with calcium-containing renal stones. The calcium output was greater than 300 mg. per day in thirty-seven patients and the mean calcium excretion was significantly higher in the stone formers than in local control groups. The mean daily urinary magnesium excretion of the " normocalciuric " renal-stone formers (seventeen patients with daily urinary calcium excretion below 300 mg.) was significantly lower than that of normocalciuric controls, similarly defined. Four of these normocalciuric patients had very low 24-hour urinary magnesium outputs. The results support the view that low urinary magnesium excretion may be a factor in the production of renal calculi in some cases; the practical value of oral magnesium salts in preventing further stones in such patients is being investigated.

SARCOIDOSIS OF THE NASAL BONES.

A survey of the recent radiological literature has failed to reveal any reports containing illustrations of sarcoid lesions of the nasal bones. The following two cases are presented to show the radiological appearances of this condition. A 32-year-old woman presented with a three months' history of a hard painless swelling of the bridge of the nose (Fig. 1) but no skin lesions or lymphadenopathy. Biopsy showed bony spicules and giant cell systems without evidence of caseation, i.e. appearances consistent with Boeck's sarcoidosis. Bacteriological examination showed no evidence of M. tuberculosis directly or on culture. Laboratory tests. Haemoglobin 87 per cent; white cell count 7,100 per cu. mm; normal differential WBC.; blood urea 13 mg per cent; electrolytes—normal; liver function tests—normal; serum calcium 9·8 mg per cent; 24-hour excretion of calcium = 242 mg (normal); alkaline phosphatase four units; Wassermann reaction—negative; Rose-Waaler test—negative; serum proteins 8·2 g per cent with increase ...