Abstract Background: Ataxia Telangiectasia (AT) is a rare autosomal recessive neurodegenerative disease caused by mutations in the ATM gene. The gene is on chromosome 11q22-23 and codes for the protein kinase ATM, which plays an essential role in DNA damage repair. The classic neurological signs of AT include progressive cerebellar ataxia, oculomotor abnormalities, movement disorders, and cognitive dysfunction. The condition presents with multisystem involvement, leading to immunodeficiency‚ cancer predisposition, oculocutaneous telangiectasia‚ and elevated serum alpha-fetoprotein levels. In this study, we review the clinical characteristics of 13 AT patients, 3 of whom displayed novel mutations. Method : Thirteen patients with ataxia-telangiectasia from 10 unrelated families were referred to Immunology, Asthma and Allergy Research Institute, Tehran, Iran. After clinical confirmation, blood samples were collected from the patients and their parents. Genetic analysis for 8 patients was conducted using whole-exome sequencing (WES); in the other 3 patients, polymerase chain reaction (PCR) was used, followed by sequencing. The mutations found via WES were confirmed by Sanger sequencing. Results: We identified 11 different mutations in ATMgene. Two patients had mutations as compound heterozygous, while 9 other patients were homozygous for the mutations. Among these, 3 likely pathogenic mutations (ie, c.4864G>T, c.2639-1G>A, and c.7940_7970delTTCCAGCAGACCAGCCAATTACTAAACTTAA) have not been reported. All parents showed a heterozygous state. Conclusion: Our study highlights the significance of next-generation sequencing techniques in identifying novel ATMmutations in AT patients. Although all reported AT mutations reside in one gene, the absence of a mutation hotspot for this gene necessitates the use of next-generation sequencing techniques. Specifically, we identified 3 mutations that have not been reported previously, emphasizing the importance of continued research in this area. This study provides new insights into the genetic underpinnings of AT and underscores the potential clinical implications of identifying novel mutations. Further research in this area can help improve diagnosis and inform potential treatments for AT.

Irreversible myocardial injury causes the exhaustion of cellular adenosine triphosphate (ATP) contributing to heart failure (HF). Cyclocreatine phosphate (CCrP) was shown to preserve myocardial ATP during ischemia and maintain cardiac function in various animal models of ischemia/reperfusion. We tested whether CCrP administered prophylactically/therapeutically prevents HF secondary to ischemic injury in an isoproterenol (ISO) rat model. Thirty-nine rats were allocated into five groups: control/saline, control/CCrP, ISO/saline (85 and 170 mg/kg/day s.c. for 2 consecutive days), and ISO/CCrP (0.8 g/kg/day i.p.) either administrated 24 h or 1 h before ISO administration (prophylactic regimen) or 1 h after the last ISO injection (therapeutic regimen) and then daily for 2 weeks. CCrP protected against ISO-induced CK-MB elevation and ECG/ST changes when administered prophylactically or therapeutically. CCrP administered prophylactically decreased heart weight, hs-TnI, TNF-α, TGF-β, and caspase-3, as well as increased EF%, eNOS, and connexin-43, and maintained physical activity. Histology indicated a marked decrease in cardiac remodeling (fibrin and collagen deposition) in the ISO/CCrP rats. Similarly, therapeutically administered CCrP showed normal EF% and physical activity, as well as normal serum levels of hs-TnI and BNP. In conclusion, the bioenergetic/anti-inflammatory CCrP is a promising safe drug against myocardial ischemic sequelae, including HF, promoting its clinical application to salvage poorly functioning hearts.

Successful organ or tissue long-term preservation would revolutionize biomedicine. Cartilage cryopreservation enables prolonged shelf life of articular cartilage, posing the prospect to broaden the implementation of promising osteochondral allograft (OCA) transplantation for cartilage repair. However, cryopreserved large sized cartilage cannot be successfully warmed with the conventional convection warming approach due to its limited warming rate, blocking its clinical potential. Here, we develope a nanowarming and ice-free cryopreservation method for large sized, intact articular cartilage preservation. Our method achieves a heating rate of 76.8 °C min-1, over one order of magnitude higher than convection warming (4.8 °C min-1). Using systematic cell and tissue level tests, we demonstrate the superior performance of our method in preserving large cartilage. A depth-dependent preservation manner is also observed and recapitulated through magnetic resonance imaging and computational modeling. Finally, we show that the delivery of nanoparticles to the OCA bone side could be a feasible direction for further optimization of our method. This study pioneers the application of nanowarming and ice-free cryopreservation for large articular cartilage and provides valuable insights for future technique development, paving the way for clinical applications of cryopreserved cartilage.

Stem cell therapy, which has promising results in acute disorders such as stroke, supports treatment by providing rehabilitation in the chronic stage patients. In acute stroke, thrombolytic medical treatment protocols are clearly defined in neurologic emergencies, but in neurologic patients who miss the "thrombolytic treatment intervention window," or in cases of hypoxic-ischemic encephalopathy, our hands are tied, and we are still unfortunately faced with hopeless clinical implementations. We consider mesenchymal stem cell therapy a viable option in these cases. In recent years, novel research has focused on neuro-stimulants and supportive and combined therapies for stroke. Currently, available treatment options are limited, and only certain patients are eligible for acute treatment. In the scope of our experience, five stroke patients were evaluated in this study, who was treated with a single dose of 1-2 × 106 cells/kg allogenic umbilical cord-mesenchymal stem cells (UC-MSCs) with the official confirmation of the Turkish Ministry of Health Stem Cell Commission. The patients were followed up for 12 months, and clinical outcomes are recorded. NIH Stroke Scale/Scores (NIHSS) decreased significantly (p = 0.0310), and the Rivermead Assessment Scale (RMA) increased significantly (p = 0.0234) for all patients at the end of the follow-up. All the patients were followed up for 1 year within a rehabilitation program. Major clinical outcome improvements were observed in the overall clinical conditions of the UC-MSC treatment patients. We observed improvement in the patients' upper extremity and muscle strength, spasticity, and fine motor functions. Considering recent studies in the literature together with our results, allogenic stem cell therapies are introduced as promising novel therapies in terms of their encouraging effects on physiological motor outcomes.

Disruption of energy homeostasis may cause diseases such as obesity and diabetes that affect millions of people every year. The adult hypothalamic stem cells, tanycytes, play critical roles in helping hypothalamic neurons maintain energy homeostasis, however the developmental trajectory of tanycytes especially in human still awaits to be discovered. In the current study, we for the first time use human embryonic single cell transcriptomics data to distinguish RAX+ tanycytes from RAX+ neural progenitors, explore human embryonic tanycyte heterogeneity, and unravel their developing trajectories. We found human embryonic tanycytes share similar subtypes with adult rodent tanycytes (α and β). We also discovered that radial glia markers FABP7 as well as astrocyte marker (e.g. AQP4) etc, are characteristics of tanycytes that distinguish them from RAX+ neural progenitors, and the α and β tanycytes follow different developmental trajectories. Our study represents a pioneer work on human embryonic tanycytes.

In response to different types and intensities of mechanical force, cells modulate their physical properties and adapt their plasma membrane (PM). Caveolae are PM nano-invaginations that contribute to mechanoadaptation, buffering tension changes. However, whether core caveolar proteins contribute to PM tension accommodation independently from the caveolar assembly is unknown. Here we provide experimental and computational evidence supporting that caveolin-1 confers deformability and mechanoprotection independently from caveolae, through modulation of PM curvature. Freeze-fracture electron microscopy reveals that caveolin-1 stabilizes non-caveolar invaginations—dolines—capable of responding to low-medium mechanical forces, impacting downstream mechanotransduction and conferring mechanoprotection to cells devoid of caveolae. Upon cavin-1/PTRF binding, doline size is restricted and membrane buffering is limited to relatively high forces, capable of flattening caveolae. Thus, caveolae and dolines constitute two distinct albeit complementary components of a buffering system that allows cells to adapt efficiently to a broad range of mechanical stimuli.

AbstractRemdesivir was the first drug to be approved for the treatment of severe COVID-19; followed by molnupiravir (another prodrug of a nucleoside analogue) and the protease inhibitor nirmatrelvir. Combination of antiviral drugs may result in improved potency and help to avoid or delay the development of resistant variants. We set out to explore the combined antiviral potency of GS-441524 (the parent nucleoside of remdesivir) and molnupiravir against SARS-CoV-2. In SARS-CoV-2 (BA.5) infected A549-Dual™ hACE2-TMPRSS2 cells, the combination resulted in an overall additive antiviral effect with a synergism at certain concentrations. Next, the combined effect was explored in Syrian hamsters infected with SARS-CoV-2 (Beta, B.1.351); treatment was started at the time of infection and continued twice daily for four consecutive days. At 4 day 4 post-infection, GS-441524 (50 mg/kg, oral BID) and molnupiravir (150 mg/kg, oral BID) as monotherapy reduced infectious viral loads by 0.5 and 1.6 log10, respectively, compared to the vehicle control. When GS-441524 (50 mg/kg, BID) and molnupiravir (150 mg/kg, BID) were combined, infectious virus was no longer detectable in the lungs of 7 out of 10 of the treated hamsters (4.0 log10reduction) and titers in the other animals were reduced by ~2 log10. The combined antiviral activity of molnupiravir which acts by inducing lethal mutagenesis and GS-441524, which acts as a chain termination appears to be highly effective in reducing SARS-CoV-2 replication/infectivity. The unexpected potent antiviral effect of the combination warrants further exploration as a potential treatment for COVID-19.

AbstractThe SARS-CoV-2 main protease (3CLpro) is one of the promising therapeutic target for the treatment of COVID-19. Nirmatrelvir is the only the 3CLpro inhibitor authorized for treatment of COVID-19 patients at high risk of hospitalization; other 3Lpro inhibitors are in development. We recently repored on the in vitro selection of a SARS-CoV2 3CLpro (L50F-E166A-L167F; short 3CLprores) virus that is cross-resistant with nirmatrelvir and yet other 3CLpro inhibitors. Here, we demonstrate that the resistant virus replicates efficiently in the lungs of intranassaly infected hamsters and that it causes a lung pathology that is comparable to that caused by the WT virus. Moreover, 3CLprores infected hamsters transmit the virus efficiently to co-housed non-infected contact hamsters. Fortunately, resistance to Nirmatrelvir does not readily develop (in the clinical setting) since the drug has a relatively high barrier to resistance. Yet, as we demonstrate, in case resistant viruses emerge, they may easily spread and impact therapeutic options for others. Therefore, the use of SARS-CoV-2 3CLpro protease inhibitors in combinations with drugs that have a different mechanism of action, may be considered to avoid the development of drug-resistant viruses in the future.