Abstract
The ATP binding cassette enzyme ABCE1 (also known as RNase-L (ribonuclease L) inhibitor, Pixie, and HP68), one of the evolutionary most sequence-conserved enzymes, functions in translation initiation, ribosome biogenesis, and human immunodeficiency virus capsid assembly. However, its structural mechanism and biochemical role in these processes have not been revealed. We determined the crystal structure of Pyrococcus abyssi ABCE1 in complex with Mg(2+) and ADP to 2.8A resolution. ABCE1 consists of four structural domains. Two nucleotide binding domains are arranged in a head-to-tail orientation by a hinge domain, suggesting that these domains undergo the characteristic tweezers-like powerstroke of ABC enzymes. In contrast to all other known ABC enzymes, ABCE1 has a N-terminal iron-sulfur-cluster (FeS) domain. The FeS domain contains two [4Fe-4S] clusters and is structurally highly related to bacterial-type ferredoxins. However, one cluster is coordinated by an unusual CX(4)CX(3/4)C triad. Surprisingly, intimate interactions of the FeS domain with the adenine and ribose binding Y-loop on nucleotide binding domain 1 suggest a linkage between FeS domain function and ATP-induced conformational control of the ABC tandem cassette. The structure substantially expands the functional architecture of ABC enzymes and raises the possibility that ABCE1 is a chemomechanical engine linked to a redox process.
Highlights
7962 JOURNAL OF BIOLOGICAL CHEMISTRY function in translation and are involved in translation elongation in fungi [5] and eukaryotic translation initiation (ABC50) [6]
Recent data suggest that the cellular and perhaps evolutionary conserved and essential function of ABCE1 is found in ribosome biogenesis, translation initiation, and/or formation of translation initiation components (9, 14 –19)
In this process yeast ABCE1 interacts with eukaryotic translation initiation factors as well as ribosomal subunits and is required for rRNA maturation and nuclear export of 40 S and 60 S subunits (14 –16, 18, 19)
Summary
Protein Expression and Purification—The coding sequence of P. abyssi ABCE1 (pabABCE1) was amplified from genomic DNA by the polymerase chain reaction using oligonucleotides AAAAAAAACATATGGTGAGGAAAATGAGGATCGCG and TTTTTTGCGGCCGCGGCGTAGTAGTATTCTCCCCTTGC. Two annealed oligonucleotides (5ЈCATGGCTAGCTGGAGCCACCCGCAGTTCGAAAAAGGCGCTCA-3Ј and 5Ј-TATGAGCGCCTTTTTCGAACTGCGGGTGGCTCCAGCTAGC-3Ј) that contain the DNA sequence for the short Strep-tag II peptide (MASWSHPQFEKGAH) were ligated into a pET28 vector (Novagen) using NcoI and NdeI restriction sites. Purified pabABCE1 was transferred into the anaerobic chamber, and the buffer containing purified ABCE1 was exchanged to 50 mM Tris (pH 8.0), 200 mM NaCl, 5 mM dithiothreitol using a disposable PD10 gel filtration column (Bio-Rad). Crystals were obtained by mixing 1 l of protein solution (50 mM Tris (pH 8.0), 150 mM NaCl, 5 mM dithiothreitol) with 1 l of reservoir solution (0.2 M calcium acetate (pH 7.3) and 20% polyethylene glycol 3350) and grew after incubation for several days at 20 °C under anaerobic conditions inside a glove box (Coy Laboratories). Crystallographic data collection and model refinement statistics ified by graphical inspection
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
