Abstract
Vinodolia fiumana was described by Radoman from Glogi spring in 1973, and later not found, thus considered extinct. In the CLECOM list Anagastina, Dalmatinella and Prespiana were classified, as subgenera, within the genus Vinodolia. After visiting the Glogi spring on several occasions, we found four specimens of V. fiumana. Its shell, soft part external morphology, radula, penis and female reproductive organs are described. Partial cytochrome oxidase subunit I mitochondrial and 18S rRNA nuclear gene sequences were used to infer phylogenetic relationships of Vinodolia. Sadleriana was found to be the sister taxon of Vinodolia, but neither Anagastina (closely related with Radomaniola), nor Dalmatinella were closely related with it.
Highlights
The monotypic genus Vinodolia, with the type species V. fiumana Radoman, 1973, was described by RADOMAN (1973) from the Glogi spring at Bribir, northern Croatia
The aim of the present study was to check the morphology of the species, and to infer phylogenetic relationships with molecular data
The PCR reaction was performed with the following primers: LCO1490 (5’-GGTCAACAAATCATAAAGATATTGG-3’) (FOLMER et al 1994) and COR722b (5’-TAAACTTCA GGGTGACCAAAAAATYA-3’) (WILKE & DAVIS 2000) for the cytochrome oxidase subunit I (COI) mitochondrial gene and SWAM18SF1 (5’-GAATGGCTCAT TAAATCAGTCGAGGTTCCTTAGATGATCCAAATC3’), and SWAM18SR1 (5’-ATCCTCGTTAAAGGGT TTAAAGTGTACTCATTCCAATTACGGAGC-3’) for the 18S rRNA gene (PALUMBI 1996)
Summary
The monotypic genus Vinodolia, with the type species V. fiumana Radoman, 1973, was described by RADOMAN (1973) from the Glogi spring at Bribir, northern Croatia. He reported this species from the Drišt spring, close to Glogi and from the spring in the Javor village, N of Martinšèica, E of Rijeka (RADOMAN 1973, 1974, 1983). Despite very fragmentary information and without any explanation, Anagastina Radoman, 1978, Dalmatinella Radoman, 1973, and Prespiana Radoman, 1973, are considered subgenera of Vinodolia in both the CLECOM list (FALKNER et al 2001), and in Fauna Europaea (BANK 2012). The aim of the present study was to check the morphology of the species, and to infer phylogenetic relationships with molecular data
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
