Use of Substrate Analogs and Mutagenesis to Study Substrate Binding and Catalysis in the Sir2 Family of NAD-dependent Protein Deacetylases

Ahlia N Khan,Peter N Lewis

doi:10.1074/jbc.m511482200

Abstract

The Sir2 family of enzymes is highly conserved throughout evolution and functions in silencing, control of life span, apoptosis, and many other cellular processes. Since the discovery of the NAD-dependent deacetylase activity of Sir2 proteins, there has been a flurry of activity aiming to uncover the mode of substrate binding and catalysis. Structural and biochemical studies have led to several proposed reaction mechanisms, yet the exact catalytic steps remain unclear. Here we present in vitro studies of yeast homolog Hst2 that shed light on the mechanism of Sir2 proteins. Using acetyl-lysine substrate analogs, we demonstrate that the Hst2 reaction proceeds via an initial SN2-type mechanism with the direct formation of an ADP-ribose-acetyl-lysine intermediate. Kinetic studies further suggest that ADP-ribose inhibits the Hst2 reaction in a biologically relevant manner. Through biochemical and kinetic analyses of point mutants, we also clarify the role of several conserved core domain residues in substrate binding, stabilization of the ADP-ribose-acetyl-lysine intermediate, and catalysis. These findings bring us a few steps closer to understanding Sir2 activity and may provide a useful platform for the design of Sir2-specific inhibitors for analysis of Sir2 function and possibly therapeutic applications.

Highlights

Km and kcat values listed were determined by kinetic analyses of Hst2 mutants as described under “Materials and Methods.”
Lineweaver-Burk plots of the data are depicted in supplemental Fig. S3
In stark contrast to WT, reaction of the Arg45 mutant with the acetylpoly-L-lysine substrate produced the ADPR intermediate rather than OAADPR product. Consistent with this result, we observed a severe decrease in kcat, but remarkably, Km values were unaffected. These results indicate that the overall loss in enzymatic activity is not due to a defect in binding of substrates or an inability to cleave nicotinamide

Summary

Methods

Sequence Alignment—Sir protein sequences were obtained from ExPASy (available on the World Wide Web at ca.expasy.org/uniprot). Alignment was performed using ClustalW [18] at the Pole Bioinformatique Lyonnais Network Protein Sequence Analysis [19] Web site (npsa-pbil.ibcp.fr/cgi-bin/npsa_automat.pl?pageϭnpsa_ clustalw.html). Structure Diagrams—Hst ternary product inhibition complex [14] (Protein Data Bank code 1Q1A) and NAD-Sir Af2 complex [12] (Protein Data Bank code 1S7G) structural data were obtained from the RCSB Protein Data Bank Expression and Purification of Proteins—Yeast HST2 open reading frame was amplified by PCR using oligonucleotides (5Ј–3Ј) CATGGGTACCATGTCTGTTTCTACCGC and TGGACTCGAGTTATTCTTTAGCGGCTTT and cloned into pET30a at the XhoI/KpnI restriction sites, to produce an N-terminal His6-tagged fusion protein. Hst point mutations were introduced by PCR mutagenesis and cloned into pET30a at the XhoI/KpnI restriction sites. The oligonucleotides used were (5Ј–3Ј) G32A (GTAATCTTTATGGTGGCTGCCGGGATATCCACTTC and GAAGTGGATATCCCGGCAGCCACCATAAAGATTAC), S36A (GTGGGTGCCGGGATAGCCACTTCTTGTGGGATAC and GTATCCCACAAGAAGTGGCTATCCCGGCACCCAC), R45A

Results

Discussion

Conclusion