Use of genetic similarity analysis for identification and study of the origin of Indonesian local goats based on X-Y sex chromosome karyotyping and cytochrome-b genes sequence

Abstract

The history and origins of Indonesian local goats are still compiled and described based on information on phenotypic characters, and there is still limited research that studies the origin of goats based on cellular and molecular analysis. The purpose of this study was to identify the origin of local goats in Indonesia based on the emergence of the profile of the sex chromosome band and the results of the Cytochrome b (Cyt-b) gene sequence. The research method is a case study with analysis of sex chromosome band profile results of preparation with G-banding and Cyt-B gene sequences. Genetic similarity analysis was performed using mitochondrial DNA (mtDNA). The sample used was whole blood from six Senduro goats, three male Etawah Grade and three Etawah goats. Chromosome preparation was done by G-Staining and analyzed by cytovision then analyzed its similarity with ancestor breeds. The whole blood sample was isolated with the Blood DNA Preparation Kit by Jena Bioscience. The primers used are Forward (Cytb_F) 5’GCAATTGCCATAGTCCACCT’3 and Reverse (Cytb_R) 5’GGATTTGCC GGGGTATAGTT ’3. The PCR results were sequenced by the Sanger method. Gene sequence analysis is performed using MEGA-X software. The results showed that the genetic distance between intraspesies and interspesies of Senduro goats and PE goats was 0% or ⩽ 2%. Conclusions based on genetic similarity from this study are Senduro goats and Etawah Peranakan goats, and Etawah has a close kinship, instead there is a distant kinship with the comparison of Capra Hircus, but it has a close kinship between individuals.