Abstract
Changes in insulin-regulated gene expression occur in a time- and tissue-dependent fashion. To monitor these changes we have adapted the S1 nuclease protection assay to allow simultaneous estimation of multiple RNA species in a single sample by using synthetic oligonucleotides of various lengths as probes for specific RNA species, which can then be resolved by electrophoresis. The multiple S1 nuclease protection assay was used to assess the influence of insulin on the RNA concentrations of 12 different genes in human skeletal muscle. Estimates obtained by this assay were comparable with those obtained by Northern analysis. RNA levels for proto-oncogene c-src displayed a transient 4-fold increase, whereas RNA levels for type 1 protein phosphatase were suppressed by 50% during the same time period. RNAs corresponding to known insulin-responsive genes such as c-fos, c-myc, c-Ha-ras, and c-src displayed rapid and transient 2-4-fold increases between 30 and 60 min as detected by either Northern analysis or the multiple S1 nuclease protection assay. In addition, RNA levels for the insulin receptor, Glut-4, Glut-3, and c-jun were apparently unaffected by exposure of the cells to insulin.
Highlights
Oligonucleotides of various lengths as probes for spe- Changes in gene expression are generally assessed by meascific RNA species, which can be resolvedelbeyctrophoresis
1980), have been used to quantitate RNA levels responsivegenes such as c-fos, c-myc, c-Ha-ras,and c- (Greene and Struhl, 1988).The advantages of the S1protecsrc displayed rapid and transient 2-4-fold increases tion assay for quantifying RNA abundance include single between 30 and 60 min as detectedby either Northern phase hybridization (Coutlee et al, 1990) and increased senanalysis or the multiple S1 nuclease protection assay. sitivity over standard Northern analysis (Melton et al, 1984; In addition, RNA levels for the insulin receptor, Glut- Wahl et al, 1987)and lower background when compared with
We used the multiple S1nuclease protection assay to assess the relative abundance of different RNA speciesin human skeletal muscle and to detect changes in RNAlevels of different genes in response to insulin in human rhabdomyosarcoma cells
Summary
AGTCATAGAGGGCCACAAAGGTGGTCACTC "Abbreviations: 18S RNA, 18 S ribosomal RNA (Torczysnki et al, 1985); insulin receptor (Ebina et al, 1985); GAPDH, glyceraldehyde-3-phosphate dehydrogenase (Hanauer and Mandell, 1984); type 1phosphatase, type 1 protein phosphatase (Barker et al, 1990);Glut-4, insulin-responsive glucose transporter (Fukomoto et al, 1989); c-jun (Hattori et al, 1988);c-fos (van Straaten et al, 1983);c-rnyc (Colby et al, 1983);myf-5 (Braun et al, 1989); Glut-3, hrain/fetal skeletal muscle glucose transporter (Kayano et al, 1988); c-Ha-ras (Reddy et al, 1982); c-src (Tanaka et al, 1987). The supernatantor cell lysate was brought to 0.2 M sodium acetate, pH 4.5, and equal volumes of water-saturated phenol and ch1oroform:isoamyl alcohol (24:l v/v) were added. The pellet was resuspended in 300 pl of 10 mM MOPS,' 5 mM EDTA, and 0.5% sodium dodecyl sulfate, pH 7.5A.n equal volume of chloroform:isoamyl alcohol (24:l) was added, the samples mixed and centrifuged at 15,000 X g for 15 min. Multiple SI Nuclease Protection Assay-Twenty pg of total RNA was hybridized to 1 X 10' cpm (1-2ng) each of labeled oligonucleotide probes, in 0.2 M NaCl, 33 mM HEPES, pH 7.5, and 1mM EDTA pH 8.0 in a total volume of 30 pl. Human skeletal musclewas obtained from the Cooperative Human Tissue Network of The University of Alabama
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
