Abstract
BackgroundVariants identified through parent–child trio-WES yield up to 28–55% positive diagnostic rate across a variety of Mendelian disorders, there remain numerous patients who do not receive a genetic diagnosis. Studies showed that some aberrant splicing variants, which are either not readily detectable by WES or could be miss-interpreted by regular detecting pipelines, are highly relevant to human diseases.MethodsWe retrospectively investigated the negative molecular diagnostics through trio-WES for 15 genetically undiagnosed patients whose clinical manifestations were highly suspected to be genetic disorders with well-established genotype–phenotype relationships. We scrutinized the synonymous variants from WES data and Sanger sequenced the suspected intronic region for deep intronic variants. The functional consequences of variants were analyzed by in vitro minigene experiments.ResultsHere, we report two abnormal splicing events, one of which caused exon truncating due to the activation of cryptic splicing site by a synonymous variant; the other caused partial intron retention due to the generation of splicing sites by a deep intronic variant.ConclusionsWe suggest that, despite initial negative genetic test results in clinically highly suspected genetic diseases, the combination of predictive bioinformatics and functional analysis should be considered to unveil the genetic etiology of undiagnosed rare diseases.
Highlights
MethodsWe retrospectively investigated the negative molecular diagnostics through trio-Whole-exome sequencing (WES) for 15 genetically undiagnosed patients whose clinical manifestations were highly suspected to be genetic disorders with wellestablished genotype–phenotype relationships
Variants identified through parent–child trio-Whole-exome sequencing (WES) yield up to 28–55% positive diagnostic rate across a variety of Mendelian disorders, there remain numerous patients who do not receive a genetic diagnosis
We retrospectively investigated the negative molecular diagnostics through trio-WES for 15 genetically undiagnosed patients whose clinical manifestations were highly suspected to be genetic disorders with well-defined phenotypes, such as Dravet syndrome (DS) or genetic epilepsy with febrile seizures plus (GEFS+) and benign familial neonatal epilepsy (BFNE)
Summary
Patients Patients were recruited from pediatric clinics from Guiyang Maternal and Child Health Care Hospital. Sanger sequencing analysis A highly conserved region in SCN1A intron 23 (GRCh38, chr2:166006890–166007890, NM_001165963.2) was amplified using the following primers: Forward-5′CGCCCTCACCAATCCAGTA -3′, Reverse-5′- AGCTGCGTCAAAGCGTAACT -3′. PCR products were sequenced and analyzed for variant detection. Sanger sequencing was used for variants confirmation and segregation analysis for family members. Minigene construction and splicing analysis For KCNQ2, a splicing reporter of 744 bp fragment containing exon14(106 bp)—intron 14(506 bp)— exon15(132 bp) was generated with wild-type or patientspecific variant (c.1617C > T). For SCN1A, a splicing reporter contained pseudo exonA, 1440 bp partial intron 23 including 64-nt conserve region with wild-type or patient-specific variant (c.4002 + 2461T > C) and pseudo exonB. 1 μl of the cDNA mixture was amplified with PrimerSTAR MAX DNA Polymerase (TaKaRa, R045A) and pcMINI vectorexpressed exon-specific PCR primers (Forward-5′-TTAACATCTGTGCGTGGATG-3′, Reverse-5′- CGCCCACCAGCTCCACACAC-3′). Amplified products were subjected to run agarose gel and sequencing analysis
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
