Two distinct bombesin receptor subtypes are expressed and functional in human lung carcinoma cells.

M.H Corjay,D.J Dobrzanski,J.M Way,J Viallet,H Shapira,P Worland,E.A Sausville,J.F Battey

doi:10.1016/s0021-9258(18)55129-2

Abstract

Bombesin-like peptides have been implicated as autocrine growth factors influencing the pathogenesis and progression of some human lung carcinoma cells. To determine the pharmacologic and structural properties of the bombesin receptors expressed in human lung carcinoma cells, cDNA clones encoding a human gastrin-releasing peptide receptor (GRP-R) and a pharmacologically distinct neuromedin-B preferring bombesin-receptor (NMB-R) were isolated from a human small cell lung carcinoma cell line (NCI-H345). After expression in Xenopus oocytes, a GRP-R-specific antagonist was effective in blocking responses elicited from the cloned GRP-R, but not the NMB-R. Both GRP-R and NMB-R mRNA expression was detected at varying levels in a panel of human lung cancer cell lines. These results indicate heterogeneity of bombesin receptor subtypes exists in human lung carcinoma cells and should be considered in the design of bombesin receptor antagonists intended to inhibit tumor cell growth.

Highlights

Bombesin-like peptides have been implicated as au- maintenance of some human small cell lung carcinoma tocrine growth factors influencing the pathogenesis and progression of some human lung carcinoma cells
Bombesin-stimulated Ca2+Mobilization in SCLC Cell Line quenced. These cloneswere found to contain the entire proctoediinng NCI-H345-Bombesin-like peptides are known to induce an region of the human GRP-R as well as several hundred basesof 5'- increase in intracellular calcium in the NCI-H345 cell line untranslated sequence
Bombesin-stimulated Ca2+mobilization studieswere performed in thehuman lung carcinoma cell primer: S 5'GTTCTCTCCAGGTAGTGAGTT 3') complementary to line NCI-H345 using quin-2 fluorescence in order to detersequences from the 5'- and 3"untranslated domains tihmamt ediately mine if one or more bombesin receptor subtypes couldbe flank thecoding region'were synthesized for use as polymerase chain active in thesecells (Fig. 1).Both bombesin and NMBelicited reaction primers

Summary

Introduction

Bombesin-like peptides have been implicated as au- maintenance of some human small cell lung carcinoma tocrine growth factors influencing the pathogenesis and progression of some human lung carcinoma cells. After expression in Xenopus oocytes, a GRP-R-specific antagonist was effective inblocking responses elicited from the cloned GRP-R, but not the NMB-R. Both GRP-R and NMB-R mRNAexpression wasdetected at varying levels in a panel of human lung cancer cell lines. Should be considered in the design of bombesin bombesin binding, and inhibit the clonal growth of the human receptor antagonists intended to inhibit tumor cell SCLC cell line NCI-H345 (Trepel et al, 1988a). A series of observationsindicate that the expression of GRP, amammalian counterpart to the amphibianpeptide bombesin (McDonald et al, 1979), and themammalian bombesin receptors may be important in the pathogenesis and mediating these effects may be a reasonable target for potent and specific antagonists

Methods

Results

Conclusion