Abstract

Subunit a is the least understood of the three subunits that compose the F0 sector in the Escherichia coli F0F1 ATP synthase. In this study, we have substituted Cys into predicted extramembranous loops of the protein and used chemical modification to obtain topographical information on the folding of subunit a. The extent of labeling of the substituted Cys residues by fluorescein-5'-maleimide was determined. The localization of reactive Cys residues was inferred from differences in the extent of labeling in inside out and right side out membrane vesicles. The NH2-terminal segment of subunit a was localized to the outside (periplasmic) surface and the COOH terminus to the cytoplasmic surface by these procedures. Loop residues in two periplasmic extramembranous loops and in two cytoplasmic extramembranous loops were also localized. The localization of two cytoplasmic Cys residues was confirmed by using 4-acetamido-4'-maleimidylstilbene-2,2'-disulfonic acid to block fluorescein-5'-maleimide labeling. From the localization of the Cys residues, a model for the topography is proposed that consists of five transmembrane segments with the NH2 terminus periplasmic and the COOH terminus cytoplasmic. The positions of second site suppressors, including several isolated here to the nonfunctional E219C and H245C substitutions, provide support for the topographical model proposed.

Highlights

  • Hϩ-transporting F1F0 ATP synthases consist of two structurally and functionally distinct sectors termed F1 and F0 [1]

  • The F1 sector lies at the surface of the membrane and in Escherichia coli consists of five subunits in a ␣3␤3␥1␦1⑀1 stoichiometry

  • Characterization of the His6-tagged Subunit a—For easy purification of subunit a, a His6 tag was introduced at the COOH terminus

Read more

Summary

EXPERIMENTAL PROCEDURES

Construction of the His6-tagged Subunit a—For the introduction of a His tag following residue 269 in subunit a, a BglII site was initially introduced at the COOH terminus of the uncB gene (which encodes subunit a).

Topography of Subunit a
GATCATCATCATCATCATCATTAA TAGTAGTAGTAGTAGTAATTCTAG
RESULTS
Inside out vesiclesa
DISCUSSION
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call