Abstract
Eukaryotic gene expression can be regulated through selective translation of specific mRNA species. Nevertheless, the limited number of known examples hampers the identification of common mechanisms that regulate translation of specific groups of genes in mammalian cells. We developed a method to identify translationally regulated genes. This method was used to examine the regulation of protein synthesis in HL-60 cells undergoing monocytic differentiation. A partial screening of cellular mRNAs identified five mRNAs whose translation was specifically inhibited and five others that were activated as was indicated by their mobilization onto polysomes. The specifically inhibited mRNAs encoded ribosomal proteins, identified as members of the 5'-terminal oligopyrimidine tract mRNA family. Most of the activated transcripts represented uncharacterized genes. The most actively mobilized transcript (termed TA-40) was an untranslated 1.3-kilobase polyadenylated RNA with unusual structural features, including two Alu-like elements. Following differentiation, a significant change in the cytoplasmic distribution of Alu-containing mRNAs was observed, namely, the enhancement of Alu-containing mRNAs in the polysomes. Our findings support the notion that protein synthesis is regulated during differentiation of HL-60 cells by both global and gene-specific mechanisms and that Alu-like sequences within cytoplasmic mRNAs are involved in such specific regulation.
Highlights
Translational control of eukaryotic gene expression can be broadly classified into two major categories: global control affecting the overall rate of protein synthesis, and selective control in which the translation rate of mRNA subsets varies in response to biological stimuli [1,2,3]
Polysomal and subpolysomal RNAs were purified from cells before and after treatment. These RNA samples were subjected to a DDRT-PCR analysis and the radioactive labeled cDNA products were separated by polyacrylamide gel electrophoresis
In the present study we demonstrate that HL-60 cellular differentiation involves both global and gene-specific regulation of translation
Summary
Materials—Sera, cell culture medium, and antibiotics were provided by Biological Industries (Beit-Haemek, Israel); standard chemicals, phorbol ester 12-O-tetradecanoyl-1-phorbol-13-acetate (TPA), dimethyl sulfoxide were purchased from Sigma. 1,25-Dehydroxyvitamin D3 was a kind gift from Zvi Bar-Shavit (Faculty of Medicine, HU, Jerusalem, Israel). The DNA probes were specific cDNAs, prepared by PCR and labeled by random priming. The optimal number of cycles for each pair of primers was determined by withdrawn aliquots of the corresponding reactions for agarose gel analysis after various number of cycles. In Vitro RNA Transcription and Translation—The DNA templates for in vitro transcription and translation were either the TA-40 pcDNA I plasmid linearized at the XhoI site (S1) or TA-40 derived fragments. These fragments were obtained by PCR reactions with T7 promoter primer TAATACGACTCACTATAGGG in combination with each of the following TA-40 specific primers: CTCACACACACAACCATCC (S2), CGGATTTGGGAAACTTTTCTATAAA (S3), and AGCTGTGCTTTACATAGCAATCTT (S4). All results are representative of at least three independent experiments
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
