Abstract

The cytokine ciliary neurotrophic factor (CNTF) and transforming growth factor-beta (TGF-beta) both induce transcription of the vasoactive intestinal peptide (VIP) gene through a 180-base pair cytokine response element (CyRE) in the VIP promoter. While CNTF induces STAT and AP-1 proteins to bind to cognate sites in the VIP CyRE, the mechanism through which TGF-beta acts to induce VIP gene transcription is not known. Here we show that Smad3 and Smad4 proteins can bind to two distinct sites within the VIP CyRE. These sites are absolutely required for the induction of VIP CyRE transcription by TGF-beta. TGF-beta induces endogenous Smad-containing complexes to bind to these sites in human neuroblastoma cells. CNTF and TGF-beta synergize to induce VIP mRNA expression and transcription through the VIP CyRE. This synergy is dependent on the Smad, STAT, and AP-1 sites, suggesting that these two independent cytokine pathways synergize through the cooperation of pathway-specific transcription factors binding to distinct sites within the VIP CyRE.

Highlights

  • Transforming growth factor-␤ (TGF-␤)1 and ciliary neurotrophic factor (CNTF) have many functions in the developing and mature nervous system

  • We have previously shown that TGF-␤ induction of vasoactive intestinal peptide (VIP) gene transcription is mediated through the VIP cytokine response element (CyRE)

  • CNTF induces STAT and AP-1 proteins to bind to their specific sites within the CyRE, and TGF-␤ induces Smad proteins to bind to Smad sites contained in the

Read more

Summary

THE JOURNAL OF BIOLOGICAL CHEMISTRY

Vol 276, No 23, Issue of June 8, pp. 19966 –19973, 2001 Printed in U.S.A. Transforming Growth Factor-␤ and Ciliary Neurotrophic Factor Synergistically Induce Vasoactive Intestinal Peptide Gene Expression through the Cooperation of Smad, STAT, and AP-1 Sites*. CNTF induces VIP gene expression through the induction of STAT and AP-1 proteins to bind to distinct sites within the CyRE [20, 35]. These cytokineinduced proteins interact with other noninduced proteins to bring about a robust activation of VIP transcription through combinatorial interactions [36]. This paper, we show that there are two Smad binding sites within the CyRE, distinct from the AP-1 and STAT sites, that are critical to the TGF-␤ regulation of VIP gene expression. We further show that the Smad, STAT, and AP-1 sites all contribute to the synergistic interaction between CNTF and TGF-␤ in the induction of VIP gene expression

EXPERIMENTAL PROCEDURES
RESULTS
GATCCATTTCCAGACATTTTGAAACTTAATTCATTTA PPP
DISCUSSION

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.