Abstract
DT-diaphorase, a homodimeric flavoenzyme, can provide for a defence mechanism against carcinogenesis mediated by dietary or environmental quinones as well as bioactivate quinone-containing chemotherapeutic drugs. Human cell lines and strains have been identified with very low or undetectable enzymatic activity and a C to T transition at nucleotide 609 of the DT-diaphorase cDNA. This single base change is predicted to result in a proline to serine change in amino acid 187. Human cells homozygous for this base transition fail to exhibit Western blot reactivity for DT-diaphorase, suggesting that this substitution results in protein instability. To directly test whether this base change affects DT-diaphorase enzymatic activity and/or protein stability in vivo, mammalian expression vectors containing DT-diaphorase cDNA with or without the nucleotide 609 base transition were transiently transfected in COS-1 cells. Co-transfection with a human growth hormone expression vector allowed normalization for transfection efficiency. COS-1 transfectants expressing the C to T base change displayed at least a tenfold reduction in DT-diaphorase activity (P < 0.001) and a two- to threefold reduction in protein levels compared with wild-type transfectants. These results are the first to detect the presence of DT-diaphorase protein coded for by the 609 base transition in mammalian cells and confirm its predicted reduced enzymatic activity.
Highlights
Reverse transcriptase polymerase chain reaction (RT-PCR) was used to amplify cDNAs using Superscript II reverse transcriptase (Gibco) and AmpliTaq polymerase (Perkin Elmer, Norwalk, CT, USA) corresponding to the DT-diaphorase open reading frame using the following primers: 5'NQOI sense: ATGCAAGCTAATCAGCGCCCCGGACTG; 3'NQO1 antisense: CGACGTCGACAAGGAAATCCAGGCTAAGGA
COS-l cells were transiently transfected with eukaryotic expression vectors containing DT-diaphorase cDNAs prepared from mRNA extracted from GM38 or 3701T skin fibroblast strains, which are homozygous for either the C or T nucleotide at position 609 respectively (Kuehl et al, 1995)
Two-way analysis of variance (ANOVA) indicated that DT-diaphorase activities in cells transfected with pRc/CMV.DTD609c or pRc/CMV.DTD609T were significantly different (P
Summary
Chemicals and reagents2,6-Dichlorophenolindophenol (DCPIP), dicoumarol, FAD, bovine serum albumin, [-NADPH, Tween-20 and Tris-HCl were obtained from Sigma Chemical (St Louis, MO, USA). Lipofectamine reagent was obtained from Life Technologies (Gibco-BRL, Burlington, ON, Canada). Recombinant human growth hormone levels in culture medium were determined using a commercially available radioimmunoassay kit (Joldan Diagnostics, Aurora, ON, Canada). Hybridoma supematants containing a mixture of two anti-DT-diaphorase monoclonal antibodies (B771, rat/human NQOI reactive; A180 human NQO1 specific) as well as purified human recombinant DT-diaphorase were supplied by Dr David Ross (University of Colorado Health Sciences Center, Denver, CO, USA). Reverse transcriptase polymerase chain reaction (RT-PCR) was used to amplify cDNAs using Superscript II reverse transcriptase (Gibco) and AmpliTaq polymerase (Perkin Elmer, Norwalk, CT, USA) corresponding to the DT-diaphorase open reading frame using the following primers: 5'NQOI sense: ATGCAAGCTAATCAGCGCCCCGGACTG (bases 23-40 of NQO,; HindIII restriction site indicated by underline); 3'NQO1 antisense: CGACGTCGACAAGGAAATCCAGGCTAAGGA (bases 879-898 of NQO,; Sail site indicated by underline)
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
