Transcriptome Sequencing of the Endangered Species Elongate Loach (Leptobotia elongata) From the Yangtze River: De novo Transcriptome Assembly, Annotation, Identification and Validation of EST-SSR Markers

Yunbang Zhang,Xiaojuan Cao,Yuanchao Zou,Yunhai Zhang,Jian Gao

doi:10.3389/fmars.2021.616727

Abstract

Elongate loach (Leptobotia elongata) is endemic to middle and upper reaches of the Yangtze River in China. Due to overfishing and habitat destruction, this loach has become an endangered species. So far, lack of reliable genetic information and molecular markers has hindered the conservation and utilization of elongate loach resources. Therefore, we here performed an Illumina sequencing and de novo transcriptome assembly in elongate loach, and then developed polymorphic simple sequence repeat markers (SSRs). After assembly, 51,185 unigenes were obtained, with an average length of 1,496 bp. A total of 23,901 expressed sequence tag-simple sequence repeats (EST-SSRs) were identified, distributing in 14,422 unigenes, with a distribution frequency of 28.18%. Out of 16,885 designed EST-SSR primers, 150 primers (3 or 4 base repetition-dominated) were synthesized for polymorphic EST-SSR development. Then, 52 polymorphic EST-SSRs were identified, with polymorphism information contents (PIC) ranging from 0.03 to 0.88 (average 0.54). In conclusion, this was the first report of transcriptome sequencing of elongate loach. Meanwhile, we developed a set of polymorphic EST-SSRs for the loach. This study will provide an important basis, namely genetic information and polymorphic SSRs, for further population genetics and breeding studies of this endangered and economic loach in China.

Highlights

Elongate loach (Leptobotia elongata), known as Queen loach, is the largest species in the Cobitidae family (Yuan et al, 2010)
The POPGENE32 (Yeh et al, 1999) software was used to assess the number of observed alleles (Na), observed heterozygosity (Ho), expected heterozygosity (He), and polymorphic information content (PIC) of each expressed sequence tag (EST)-simple sequence repeat markers (SSRs)
That’s why Chinese government has planned to carry out a ten-year forbidden fishing in the Yangtze River, which will be fully implemented since January 1, 2021 (Huang, 2020)

Summary

INTRODUCTION

Elongate loach (Leptobotia elongata), known as Queen loach, is the largest species in the Cobitidae family (Yuan et al, 2010). Due to over-fishing, pollution of the water environment and the construction of water conservancy projects, the resources and distribution area of elongate loach have been seriously reduced (Liang et al, 2009; Yuan et al, 2010) This loach is currently listed as a highly endangered fish in the “China Species Red List” (Yue and Chen, 1998). The RNAseq technology combined with bioinformatics can generate extensive data in a very cost-effective way (Parchman et al, 2010; Ekblom and Galindo, 2011; Harkess et al, 2017; Mercati et al, 2019) It facilitates the acquisition of a large number of gene sequences, but is conducive to develop expressed sequence tag (EST)-derived markers (Qiao et al, 2014; Weisberg et al, 2017; Penin et al, 2019). This study will benefit for studies of population genetics, gene functions and genetic breeding in elongate loach and other related species

Ethics Statement

RESULTS AND DISCUSSION

F: CTGTAACTCGCCCGTCTCTC R: TACTATTTGGGGTGCGGAAA F: ATCCACCCCAATCATTTTGA R

ETHICS STATEMENT