Transcription-coupled and Transcription-independent Repair of Cyclobutane Pyrimidine Dimers in the Dihydrofolate Reductase Gene

Wenwei Hu,Zhaohui Feng,Lawrence A Chasin,Moon-Shong Tang

doi:10.1074/jbc.m206375200

Abstract

Using a ligation-mediated polymerase chain reaction technique, we have mapped the repair of ultraviolet light-induced cyclobutane pyrimidine dimers (CPDs) at the nucleotide level in exons 1, 2, and 5 of the dihydrofolate reductase (DHFR) gene in Chinese hamster ovary cells. We found that CPDs are preferentially repaired in the transcribed strand (T strand) and that the order of repair efficiency is exon 1 > exon 2 > exon 5. In the cells with a deletion of the DHFR gene encompassing the promoter region and the first four exons, CPDs are not repaired in the T strand of the residual DHFR gene. These results substantiate the idea that the preferential repair of CPDs in the T strand is transcription dependent. However, in the wild type gene we have found that CPDs are efficiently repaired in the nontranscribed strand (NT strand) of exon 1 but not in the NT strand of exons 2 and 5. Probing the chromatin structure of exons 1, 2, and 5 of the DHFR gene with micrococcal nuclease revealed that the exon 1 region is much more sensitive to micrococcal nuclease digestion than the exon 2 and exon 5 regions, suggesting that the chromatin structure in the exon 1 region is much more open. These results suggest that, although preferential repair of the T strand of the DHFR gene is transcription dependent, repair of the NT strand is greatly affected by chromatin structure.

Highlights

Both prokaryotic and eukaryotic organisms have developed multiple pathways for the repair of major ultraviolet lightinduced photoproducts such as cyclobutane pyrimidine dimers (CPDs)1 of which nucleotide excision repair (NER) is the major pathway
Using a T4 endo V incision method in combination with a ligation-mediated polymerase chain reaction (LMPCR), we found that CPDs are efficiently repaired in both strands of the endogenous adenine phosphoribosyltransferase (APRT) gene in Chinese hamster ovary (CHO) cells and that this repair is independent of transcription [18]
CPDs Are Efficiently Repaired in the NT Strand of Exon 1 but Not of Exons 2 and 5— CPDs are poorly repaired in the NT strand of exons 2 and 5, CPDs are efficiently repaired in the NT strand of exon 1; CPDs in the NT strand of exon 1 are repaired at a rate similar to that of the T strand, being almost completely repaired within 24 h (Fig. 1 and Fig. 2)

Summary

EXPERIMENTAL PROCEDURES

Cell Lines and Culture Conditions—CHO-AT3-2 cells are DHFRϩ and contain diploid DHFR loci; both loci are transcriptionally active. The cells were lysed, and DNA was isolated and purified as described previously [18]. Mapping the Repair of CPDs at the Nucleotide Level in Exons 1, 2, and 5 of the DHFR Gene—A known quantity of purified genomic DNA was treated with T4 endo V followed by photoreactivation and subjected to LMPCR as described previously [18, 20]. Oligonucleotide primers 1-1, 1-4, 2-1, 2-4, 5-1, and 5-4 were the sequence primers used in the first primer extension step of LMPCR; primers 1-2, 1-5, 2-2, 2-5, 5-2, and 5-5 were the PCR primers; and primers 1-3, 1-6, 2-3, 2-6, 5-3, and 5-6 were used to make the hybridization probes. After LMPCR, equivalent counts of 32P representing equivalent amounts of template DNA for each time point of the reaction were loaded into each lane of the sequencing gel.

5–6 CGTGTCACTTTCAAATTCCTGCATGA

RESULTS

DISCUSSION