Transcriptional Regulation of the Mouse Uncoupling Protein-2 Gene: DOUBLE E-BOX MOTIF IS REQUIRED FOR PEROXISOME PROLIFERATOR-ACTIVATED RECEPTOR-γ-DEPENDENT ACTIVATION

Alexander V Medvedev,Sheridan K Snedden,Serge Raimbault,Daniel Ricquier,Sheila Collins

doi:10.1074/jbc.m010587200

Abstract

Uncoupling protein-2 (UCP2) is present in many tissues with relevance to fuel metabolism, and its expression is increased in fat and muscle in response to elevated circulating free fatty acids resulting from fasting and high fat feeding. We proposed a role for peroxisome proliferator-activated receptor-gamma (PPARgamma) as a mediator of these physiological changes in UCP2, because thiazolidinediones also increase expression of UCP2 in these cell types (). To determine the molecular basis for this regulation, we isolated the 7.3-kilobase promoter region of the mouse UCP2 gene. The -7.3-kilobase/+12-base pair fragment activates transcription of a reporter gene by 50-100-fold. Deletion and point mutation analysis, coupled with gel shift assays, indicate the presence of a 43-base pair enhancer (-86/-44) that is responsible for the majority of both basal and PPARgamma-dependent transcriptional activity. The distal (-86/-76) part of the enhancer specifically binds Sp1, Sp2, and Sp3 and is indistinguishable from a consensus Sp1 element in competition experiments. Point mutation in this sequence reduces basal activity by 75%. A second region (-74/-66) is identical to the sterol response element consensus and specifically binds ADD1/SREBP1. However, deletion of this sequence does not affect basal transcriptional activity or the response to PPARgamma. The proximal portion of the enhancer contains a direct repeat of two E-Box motifs, which contributes most strongly to basal and PPARgamma-dependent transcription of the UCP2 promoter. Deletion of this region results in a 10-20-fold reduction of transcriptional activity and complete loss of PPARgamma responsiveness. Point mutations in either E-Box, but not in the spacer region between them, eliminate the stimulatory response to PPARgamma. However, gel shift assays show that PPARgamma does not bind to this region. Taken together, these data indicate that PPARgamma activates the UCP2 gene indirectly by altering the activity or expression of other transcription factors that bind to the UCP2 promoter.

Highlights

Uncoupling protein-2 (UCP2) is present in many tissues with relevance to fuel metabolism, and its expression is increased in fat and muscle in response to elevated circulating free fatty acids resulting from fasting and high fat feeding
In response to high fat diets, we have previously reported adipose-specific increases in expression of UCP2 in obesity-resistant mouse strains such as A/J and C57BL/Kalis, which are absent from the obesity-prone C57BL/6J strain of mice [2, 4]
To analyze the mechanisms responsible for the transcriptional regulation of the mouse UCP2 gene, and to test whether PPAR␥ affects the activity of the UCP2 promoter, a fragment of the mouse UCP2 promoter region from position Ϫ7359 to ϩ12 was isolated, sequenced, and subcloned into a luciferase reporter vector

Summary

EXPERIMENTAL PROCEDURES

Cloning of Mouse UCP2 Promoter and Construction of Deletion and Point Mutants in Luciferase Reporter Plasmids—A mouse genomic library (129 SVJ mouse DNA digested by Sau3A DNA and inserted into lambda FIX II vector, catalog number 946306; Stratagene, Palo Alto, CA) was screened using a 1,304-bp PCR probe encompassing intron 1 and exon II of the mouse UCP2 gene. Cells were washed twice with calcium-free phosphate-buffered saline and incubated with 1 ml/ well of transfection mixture, which contained 4 ␮l of LipofectAMINE (Life Technologies, Inc.) and 1.5 ␮g of total amount of DNA prepared in serum-free, antibiotic-free F-12 medium according to the manufacturer’s protocol (Life Technologies, Inc.). The nuclei were resuspended in 10 volumes of high salt buffer (10 mM HEPES, pH 7.9, 1 mM EDTA, 0.42 M NaCl, 10% glycerol, and protease inhibitors) and incubated on ice for 20 min followed by a 10-min centrifugation in a microcentrifuge at 4 °C. 0.2 ng (50,000 cpm) of the oligonucleotide probe and 0.5 ␮g of nuclear extract were routinely used in the binding reaction in buffer containing 20 mM HEPES, pH 7.9, 50 mM NaCl, 1 mM EDTA, 1 mM phenylmethylsulfonyl fluoride, and 10% glycerol. The intensity of hybridization signals was quantified by a phosphorimager (ImageQuant/Storm) and normalized to the values for cyclophilin

RESULTS

DISCUSSION

CGCCACGCCCCGTTTACCACGCCCTCTAGA CCACGCCCTCTAGA