Abstract

In order to characterize the molecular mechanisms that dictate microsomal triglyceride transfer protein (MTP) gene transcription in human and hamster, two species with similar plasma lipoprotein profiles, the MTP gene promoters were cloned, sequenced, and functionally characterized by transient transfection analysis. The results presented in this report indicate that the 5' ends of human and hamster MTP genes share similar structural features. The promoter sequences are well conserved and consist of similar functional elements. Transient transfection analysis of MTP promoter-driven luciferase gene expression showed that the promoter is active in liver and intestinal cells but not in epithelial cells, consistent with endogenous MTP gene expression. The -123 to -85 bp region of the human promoter is critical for the expression and contains the consensus recognition sequences for liver cell-specific factors HNF-1 and HNF-4 and activator protein AP-1. The promoter contains a modified sterol response element and a negative insulin response element. The human promoter activity is positively regulated by cholesterol and negatively regulated by insulin. From the functional analysis of MTP promoters, it is concluded that the elements that regulate the cell type-specific expression in human and hamster are well conserved and that insulin and cholesterol can regulate the activity of the MTP promoter in opposite directions.

Highlights

  • In order to characterize the molecular mechanisms cDNA and gene havebeen cloned and the gene, abou5t 5 kb in that dictate microsomaltriglyceridetransferprotein length, islocalized to the short arm of chromosome 4 at position (MTP) gene transcription in human and hamster, two 4q24 (2)

  • From thefunctional order to characterize the molecular mechanisms that dictate analysis of MTP promoters, it is concluded that theele- the MTP tissue-specifitcranscriptioannrdegulation by ments that regulatethe cell type-specific expression in metabolicregulatorsinhumansandhamsters,twospecies human and hamster are well conserved and itnhsautlin with similar plasma lipoprotein profiles, their MTP 5' regulaand cholesterolcan regulate theactivityof theMTP pro- toreylementws erceloneds,equenceda,nfdunctionally moter in opposite directions

  • Transcription of the humanMTP is initiated from a purine present in a stringof pyrimidine nucleotides,and transcription of the hamster MTP is initiated from a purine, present six nucleotidesfurther upstream(2,5).The analysis of human and hamster MTP 5"flanking sequence revealed over 70% sequencehomology in the firs2t00 bp, and beyond this the conservation was found only in small pockets 10-12bp long (Fig. lb)

Read more

Summary

MATERIALS AND METHODS

Microsomaltriglyceridetransferprotein (MTP)' catalyzes Cloningand Mapping ofthe PromoterRegion-A dash I1recombinant the transfer of triglycerides, cholesteryl esters, and phospho- phage containing human MTP gene fragment and hamster genomic lipids between the phospholipid surfaces, and it is found in DNAlibrary in A fix vector(Stratagene,La Jolla, CAI, respectively, were endoplasmic reticulumof hepatocytes and enterocytes where is involved in the assembloyf apolipoprotein B (apoB) containitSscDreSenweidthbya hybridization at 65 "C in 6 x SSC buffer containing 0.25% randomly primed, 32P-labeled 0.5-kbhuman and hamster. The polymerase chain reaction fragments, tailored response element; SREBP-1,sterol response element binding protein-1; to contain a KpnI site at the 5' end and a BanHI site at the 3' end, after kb, kilobase(s);bp, base pair(s); FBS, fetal bovine serum. Dansient Dansfection Analysis-The relative transcriptional activities of MTP promoter fragments were determined by transient transfection analysis in monolayer cultures of HepG2, CaCo2, and HeLa cells.Typically,cellsweregrown overnight in a 35-mm plate and washed twice with serum-free medium. Cholesterol Effect-For determining the effect of sterols, the HepG2 cells weretransiently cotransfectedwith MTP-luciferaseor LDL recep tor-luciferaseand rpL30-CATreporter constructs and grown in medium containing 2.5%delipidated FBS, 1.0 pg/ml25-OH cholesterol,and 10.0 pg/ml cholesterolas described previously(11).An equal volume of carrier ethanol was added to control cellsT. ransfectedcells were harvested after 48 h and assayed for enzyme activities

RESULTS
GCTGGTTTAGTTTGGCTCTCAAGATGAAAACTTCCTTGAITTTTCCTT CTTGAATGAAACACATTTCTTAA
Danscriptional Regulation of MTP Genes
Activity Hamcsotenrstructs
DISCUSSION
Transcriptional Regudation of MTP Genes
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call