Abstract
Intracellular calcium signaling is critical for initiating and sustaining diverse cellular functions including transcription, synaptic signaling, muscle contraction, apoptosis and fertilization. Trans-membrane 203 (TMEM203) was identified here in cDNA overexpression screens for proteins capable of modulating intracellular calcium levels using activation of a calcium/calcineurin regulated transcription factor as an indicator. Overexpression of TMEM203 resulted in a reduction of Endoplasmic Reticulum (ER) calcium stores and elevation in basal cytoplasmic calcium levels. TMEM203 protein was localized to the ER and found associated with a number of ER proteins which regulate ER calcium entry and efflux. Mouse Embryonic Fibroblasts (MEFs) derived from Tmem203 deficient mice had reduced ER calcium stores and altered calcium homeostasis. Tmem203 deficient mice were viable though male knockout mice were infertile and exhibited a severe block in spermiogenesis and spermiation. Expression profiling studies showed significant alternations in expression of calcium channels and pumps in testes and concurrently Tmem203 deficient spermatocytes demonstrated significantly altered calcium handling. Thus Tmem203 is an evolutionarily conserved regulator of cellular calcium homeostasis, is required for spermatogenesis and provides a causal link between intracellular calcium regulation and spermiogenesis.
Highlights
Calcium is a ubiquitous second messenger that controls a large number of functions, both cell specific, such as muscle contraction and synaptic activity, and broad, such as modulation of gene transcription and apoptosis [1]
IP3 Receptor (IP3R) antibody (# 610312) from BD Bioscience, INSIG1 (Cat #ab70781) from Abcam and M2 FLAG from Sigma Aldrich. siRNA against Human Trans-membrane 203 (TMEM203) were from Qiagen—siRNA TMEM203— CAGGCACTGCTTGGCTTACTA (Cat #-SI00633185); control siRNA were purchased from Dharmacon-Thermo Scientific—Non-Targeting siRNA #1(Cat #-D-001210-01-05)
Addition of the calcium chelator, EGTA, blocked TMEM203 induced nuclear CRTC1, and this inhibition was reversed by the addition of excess calcium
Summary
Calcium is a ubiquitous second messenger that controls a large number of functions, both cell specific, such as muscle contraction and synaptic activity, and broad, such as modulation of gene transcription and apoptosis [1]. Central to its use as a second messenger, cytoplasmic calcium concentrations are kept very low (less than 0.1μM) by actively pumping calcium out of the cell and into intra-cellular stores, the best characterized of which is the endo(sarco)plasmic reticulum (ER) where calcium concentration are ~ 1 mM [2]. TMEM203 Regulates ER Calcium Levels decision to publish, or preparation of the manuscript. The specific roles of these authors are articulated in the ‘author contributions’ section
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
