Abstract

We have generated mice with targeted inactivation of the Plod1 gene for lysyl hydroxylase 1 (LH1). Its human mutations cause Ehlers-Danlos syndrome VIA (EDS VIA) characterized by muscular hypotonia, joint laxity, and kyphoscoliosis. The Plod1(-/-) mice are flaccid and have gait abnormalities. About 15% of them died because of aortic rupture and smooth muscle cells in non-ruptured Plod1(-/-) aortas showed degenerative changes. Collagen fibrils in the Plod1(-/-) aorta and skin had an abnormal morphology. The LH activity level in the Plod1(-/-) skin and aorta samples was 35-45% of that in the wild type. The hydroxylysine content was decreased in all the Plod1(-/-) tissues, ranging from 22% of that in the wild type in the skin to 75 and 86% in the femur and lung. The hydroxylysylpyridinoline crosslinks likewise showed decreases in all the Plod1(-/-) tissues, ranging from 28 and 33% of that in the wild type in the aorta and cornea to 47 and 59% in femur and tendon, while lysylpyridinolines were increased. The hydroxylysines found in the Plod1(-/-) collagens and their cross-links were evidently synthesized by the other two LH isoenzymes. Few data are available on abnormalities in EDS VIA tissues other than the skin. Plod1(-/-) mice offer an in vivo model for systematic analysis of the tissue-specific consequences of the lack of LH1 activity and may also provide a tool for analyzing the roles of connective tissue in muscle function and the complex interactions occurring in the proper assembly of the extracellular matrix.

Highlights

  • 6588 JOURNAL OF BIOLOGICAL CHEMISTRY sequences [1]

  • Muscle hypotonia with joint laxity is already present in neonates and recurrent joint dislocations are common later in life

  • Muscle hypotonia is observed in the Plod1Ϫ/Ϫ mice, later in life

Read more

Summary

EXPERIMENTAL PROCEDURES

Construction of the Targeting Vector and Gene Targeting in Embryonic Stem Cells—A clone containing the Plod gene was isolated from a murine 129SV genomic library (Stratagene) using a human LH1 cDNA fragment [2] as a probe. The linearized construct was introduced into W4 embryonic stem (ES) cells (Taconic) and colonies that survived G418 selection were screened by PCR using the forward primer CCATCAAGCAAGACTCAG from intron 1 of the Plod gene and the reverse primer CTGGATCTTGTAGTTGAAGAAC from exon 2 for the wild-type allele, and the same forward primer with the reverse primer ACCCTGCCATAAAGAAACTGT from the lacZ cassette for the mutant allele (Fig. 1A). Excess 9-fluorenylmethyl chloroformate was removed by repeated pentane extraction steps and the final samples were diluted in 25% acetonitrile in 0.1 M borate buffer, pH 8.0, and analyzed with reverse-phase high-performance liquid chromatography using a TosoHaas TSKgel ODS-80-TM column and a Jasco fluorescent detector, with homoarginine as an internal standard. The values are given as number per collagen triple helix, i.e. three collagen polypeptide chains

RESULTS
Autopsy finding
Aorta Skin
DISCUSSION
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.