Abstract
Protein nucleases and RNA enzymes depend on divalent metal ions to catalyze the rapid hydrolysis of phosphate diester linkages of nucleic acids during DNA replication, DNA repair, RNA processing, and RNA degradation. These enzymes are widely proposed to catalyze phosphate diester hydrolysis using a "two-metal-ion mechanism." Yet, analyses of flap endonuclease (FEN) family members, which occur in all domains of life and act in DNA replication and repair, exemplify controversies regarding the classical two-metal-ion mechanism for phosphate diester hydrolysis. Whereas substrate-free structures of FENs identify two active site metal ions, their typical separation of > 4 A appears incompatible with this mechanism. To clarify the roles played by FEN metal ions, we report here a detailed evaluation of the magnesium ion response of T5FEN. Kinetic investigations reveal that overall the T5FEN-catalyzed reaction requires at least three magnesium ions, implying that an additional metal ion is bound. The presence of at least two ions bound with differing affinity is required to catalyze phosphate diester hydrolysis. Analysis of the inhibition of reactions by calcium ions is consistent with a requirement for two viable cofactors (Mg2+ or Mn2+). The apparent substrate association constant is maximized by binding two magnesium ions. This may reflect a metal-dependent unpairing of duplex substrate required to position the scissile phosphate in contact with metal ion(s). The combined results suggest that T5FEN primarily uses a two-metal-ion mechanism for chemical catalysis, but that its overall metallobiochemistry is more complex and requires three ions.
Highlights
Key cellular processes such as DNA replication, DNA repair, RNA processing, and RNA degradation require the rapid
To clarify the roles played by flap endonucleases (FENs) metal ions, we report here a detailed evaluation of the magnesium ion response of T5FEN
Stimulation of FEN Catalysis by Magnesium Ions—To elucidate the role and minimal number of metal ions involved in the T5FEN-catalyzed reaction, kinetic parameters were monitored as a function of magnesium ion concentration
Summary
Materials—T5FEN was purified to homogeneity as described [18]. HP5F substrate (5Ј-FAM-pd(CGCTGTCGAACACACGCTTGCGTGTGTTC)) was prepared as described [19] and after purification, divalent metal ion contaminants were removed by treatment with Chelex resin. Plots of v/[E] versus [S], where [S] ϽϽ Km and 29[S] Յ [Mg2ϩ]/10 were used to determine kcat/Km. Calcium Inhibition—Reaction mixtures containing 0.1 or 2 mM MgCl2, HP5F (3 or 1 M, respectively), 25 mM potassium glycinate, pH 9.3, 0.1 mg/ml bovine serum albumin, appropriate amounts of T5FEN (400 –1500 pM), and varying CaCl2 with the appropriate amount of KCl to maintain the same ionic strength in all experiments, were used to determine the initial rate of reaction in the presence of Ca2ϩ. For manganese-supported reactions, reaction mixtures contained 100 M MnCl2, 100 nM HP5F, 25 mM MOPS, pH 7.5, 0.1 mg/ml bovine serum albumin, 200 –1500 pM T5FEN, and CaCl2 with the appropriate amount of KCl. Reactions were analyzed as above to determine kobs (kobs ϭ v/[E]) as a function of calcium ion concentration. Ware, Reading, PA) where appropriate weighted according to individual error values, using Equations 1–7 (see “Results”)
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
