The val 606met mutation in the cardiac beta-myosin heavy chain gene in patients with familial hypertrophic cardiomyopathy is associated with a high risk of sudden death at young age

Abstract

F hypertrophic cardiomyopathy (FHC) is a phenotypically and genetically heterogenous myocardial disease with an autosomal dominant pattern of inheritance. FHC is a frequent cause of sudden death in young people. Knowledge of morbidity and mortality associated with different mutations in the different sarcomere genes associated with FHC may prove to be of importance for clinical decisions concerning treatment, thus, leading to improved patient management. Hence, based on genotype-phenotype analyses, mutations in the MYBPC3 encoding the cardiac myosin-binding protein C gene have generally been associated with a low morbidity and mortality early in life.1 Mutations in the TNNT2 gene encoding cardiac troponin T have been associated with a high incidence of sudden death at young age,2,3 whereas the prognosis associated with different mutations in the MYH7 gene encoding the cardiac b-myosin heavy chain (bMHC) have been more variable.2 FHC families often have their own “private” mutation, and the prognosis of FHC may vary between, as well as within, families with the same mutation, thereby compromising the value of the genotyping. The ValMet mutation is often presented as the prototype of a “benign” MYH7 gene mutation.4–7 We report the unfavorable prognosis in a family with FHC associated with the ValMet mutation in the MYH7 gene and provide cumulated data on the incidence of sudden death at young age based on the present and previously published studies. • • • From a consecutive cohort of 70 families with FHC, family JO of Danish origin was included in the present study at the The Heart Center, Rigshospitalet, University of Copenhagen. After informed consent was given (Local Science Ethics Committee, Copenhagen. Protocol No. KF V92213), patient and family histories were obtained, and physical examination, electrocardiography, and transthoracic echocardiography were performed. The clinical diagnosis of FHC in relatives was based on: (1) electrocardiographic criteria: pathologic Q-waves or signs of left ventricular hypertrophy,8,9 and/or (2) echocardiographic criteria: a maximal left ventricular wall thickness of $13 mm,8,9 in the absence of evidence of other specific heart muscle diseases.10 For family members with disease, clinical records, family histories, or both were obtained whenever available. The clinical diagnosis was made before molecular genetic analysis. Blood samples were collected from probands and family members. Genomic DNA was extracted using a QIAamp DNA purification kit (Qiagen, Hilden, Germany). Mutation analysis of the MYH7 gene was performed using single-strand conformation polymorphism-heteroduplex (SSCP-HD) formation analysis on exons 3–23.11 Specifically for exon 16 the primers were 16F, GTGATGCTCTCTCCTGCTTCCTCA, and 16R, CCGGGAGCCTCAGTCCCTACTT. DNA preparations from 100 randomly selected Guthriecards were used as controls (Local Science Ethics Committee, Copenhagen. Protocol No. 01 to 119/99). Nucleotide sequence determination was performed by cycle sequencing using a Dye Deoxy Terminator Cycle Sequencing kit (Perkin Elmer, Foster City, California) on an ABI373 DNA sequencer (Perkin Elmer). The presently reported family, JO, were also screened for mutations in 7 other cardiac sarcomere genes known to be associated with FHC. The pedigree of family JO is shown in Figure 1. The proband (V:1, 45 years of age) was diagnosed at the age of 15 years. His previously asymptomatic son (VI:1) died suddenly at the age of 14 years. Postmortem examination confirmed the diagnosis of severe hypertrophic cardiomyopathy. The family history revealed 2 additional sudden deaths at young age (I:1 before 30 years of age and IV:1 at the age of 16 years). No additional information concerning these deaths was available. The proband’s sister (V:3, 40 years of age) has FHC, but only with few symptoms, despite pronounced septal hypertrophy and atrial fibrillation. Neither the proband’s mother nor father was available for inclusion in the study. The proband’s 2 daughters (VI:2, 23 years of age and VI:3, 16 years of age) both developed FHC during adolescence. Reports of syncope, nonsustained ventricular tachycardia on Holter monitoring, or abnormal blood pressure response during exercise, and the present family history, led to From the Department of Medicine B, The Heart Centre, Rigshospitalet, University of Copenhagen; and Department of Clinical Biochemistry, Statens Serum Institut, Copenhagen, Denmark. The study was supported by grants from The Danish Heart Foundation; The “Kong Christian den Tiendes Fond”; The Novo Nordisk Foundation; Director Emil C. Hertz and Inger Hertz’s Foundation; Danish Medical Association Research Foundation; and H:S—Copenhagen Hospital Corporation, Copenhagen, Denmark. Dr. Christiansen’s address is: Department of Clinical Biochemistry, Statens Serum Institut, 5 Artillerivej, DK-2300 S., Copenhagen, Denmark. E-mail: mic@ssi.dk. Manuscript received October 8, 2000; revised manuscript received and accepted December 28, 2000.