The Tm7sf2 Gene Deficiency Protects Mice against Endotoxin-Induced Acute Kidney Injury.

Angelo Sidoni,Partha Mukhopadhyay,Alba Minelli,Rita Roberti,Leonardo Gatticchi,Ilaria Bellezza,Rachele Del Sordo,Matthew J. Peirce

doi:10.1371/journal.pone.0141885

Abstract

Cholesterol is essential for diverse cellular functions and cellular and whole-body cholesterol homeostasis is highly controlled. Cholesterol can also influence cellular susceptibility to injury. The connection between cholesterol metabolism and inflammation is exemplified by the Tm7sf2 gene, the absence of which reveals an essential role in cholesterol biosynthesis under stress conditions but also results in an inflammatory phenotype, i.e. NF-κB activation and TNFα up-regulation. Here, by using Tm7sf2+/+and Tm7sf2−/− mice, we investigated whether the Tm7sf2 gene, through its role in cholesterol biosynthesis under stress conditions, is involved in the renal failure induced by the administration of LPS. We found that the loss of Tm7sf2 gene results in significantly reduced blood urea nitrogen levels accompanied by decreased renal inflammatory response and neutral lipid accumulation. The increased expression of fatty acids catabolic enzymes reduces the need of the renal autophagy, a known crucial nutrient-sensing pathway in lipid metabolism. Moreover, we observed that the Tm7sf2 insufficiency is responsible for the inhibition of the NF-κB signalling thus dampening the inflammatory response and leading to a reduced renal damage. These results suggest a pivotal role for Tm7sf2 in renal inflammatory and lipotoxic response under endotoxemic conditions.

Highlights

Sepsis is a complex disease arising from the host response to an overwhelming infection
We showed that the Tm7sf2 gene directs an anti-inflammatory loop and its absence correlates with an inflammatory phenotype, characterised by NF-κB activation and tumour necrosis factor α (TNFα) up-regulation
We assumed that the loss of the Tm7sf2 gene, hitherto primarily implicated in cholesterol biosynthesis, might underlie an impaired cholesterol homeostasis/metabolism resulting in an altered response to renal LPS-injury

Summary

Introduction

Sepsis is a complex disease arising from the host response to an overwhelming infection. Because of the complex transcriptional regulatory network connecting cholesterol/lipid homeostasis and inflammation, we hypothesised that: i) these effects of Tm7sf gene deficiency might be causally linked; ii) defects in cholesterol biosynthesis might in turn disrupt the finely tuned regulation of the transcriptional factors involved in the inflammatory response. To further investigate this connection and because our previous data linked Tm7sf expression to renal TNF expression [10], a key feature of renal pathology in sepsis [7,8], here we investigated the effects of Tm7sf gene insufficiency in a model of experimental endotoxemia and kidney failure induced by the administration of LPS

Materials and Methods

Ethics Statement

F: CCAGACGGAGCCGGAAGGGT R: GTGCCCATGTCCTCGGGAGC F: GAATTTGGCATCGCAGACCC R

Results

Discussion

Conclusions