Abstract

The study of the Toxic Effects of Ochratoxin A the purified from fungus Aspergillus niger in vivo of White rats and Evaluating the Ability of the Bio-lotion Floramil in the Reduction of Its Toxicity.

Highlights

  • Ochratoxin A, Aspergillus niger, biotechnology Thin layer Chromatography (TLC) shows that seven isolates producing this toxin out f 20 isolates and the most productive lotion Floramil

  • The study has the selection of isolates of A.niger fungus and Received: 15 September 2016 Final Accepted: 24 October 2016 Published: October 2016 examining their ability to produce the Ochratoxin A and defining the toxic effects on some of the anatomic properties of the males of white rat

  • Assessing the capability of the bio-lotion Floraml in reducing its toxicity, and when testing the ability of isolates of the fungus that is examined to produce the Ochratoxin A by the use of the Ochratoxin A, Aspergillus niger, biotechnology Thin layer Chromatography (TLC) shows that seven isolates producing this toxin out f 20 isolates and the most productive lotion Floramil

Read more

Summary

RESEARCH ARTICLE

The study of the Toxic Effects of Ochratoxin A the purified from fungus Aspergillus niger in vivo of White rats and Evaluating the Ability of the Bio-lotion Floramil in the Reduction of Its Toxicity. Nada Ahmed Fairooz[1] and Abdul Ameer Sameer[2]. Of Biology, College of sciences, Al-Qadissiyah University. 2. A research paper Extracted from Master Thesis for the First Researcher

Manuscript History
Identifying The Ochratoxin A
Extracting and Multiplication The DNA
Sequence F CCCAGTTCGGTTTTGCACTG R GCCCGTCAGTAACATGGGAA
Number produce Ochratoxin
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call

Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.