Abstract
Nonstructural (NS) protein 3 is a DEXH/D-box motor protein that is an essential component of the hepatitis C viral (HCV) replicative complex. The full-length NS3 protein contains two functional modules, both of which are essential in the life cycle of HCV: a serine protease domain at the N terminus and an ATPase/helicase domain (NS3hel) at the C terminus. Truncated NS3hel constructs have been studied extensively; the ATPase, nucleic acid binding, and helicase activities have been examined and NS3hel has been used as a target in the development of antivirals. However, a comprehensive comparison of NS3 and NS3hel activities has not been performed, so it remains unclear whether the protease domain plays a vital role in NS3 helicase function. Given that many DEXH/D-box proteins are activated upon interaction with cofactor proteins, it is important to establish if the protease domain acts as the cofactor for stimulating NS3 helicase function. Here we show that the protease domain greatly enhances both the direct and functional binding of RNA to NS3. Whereas electrostatics plays an important role in this process, there is a specific allosteric contribution from the interaction interface between NS3hel and the protease domain. Most importantly, we establish that the protease domain is required for RNA unwinding by NS3. Our results suggest that, in addition to its role in cleavage of host and viral proteins, the NS3 protease domain is essential for the process of viral RNA replication and, given its electrostatic contribution to RNA binding, it may also assist in packaging of the viral RNA.
Highlights
NS3 contains two RecA fold domains that comprise the ATPase site and the platform for RNA binding, which is supplemented by domain 3, which sits atop D1 and D2 [1]
We show that the serine protease domain confers strong, specific RNA binding affinity to NS3, thereby enabling the helicase domain (NS3hel) to recognize and unwind RNA substrates
Our results extend the functional importance of the protease domain and imply a role for this motif in diverse aspects of the viral life cycle
Summary
The gene fragments were produced using ExTaq PCR (Takara) and inserted into pET-SUMO according to the manufacturer’s protocol (Invitrogen). The RNA oligonucleotides used in this assay were TS34 (the 34-mer “top strand” RNA oligonucleotide of the unwinding substrate RNA 1 [19]: 5Ј-CUGUGGCAUGUCCUAGCGUCGUAUCGAUCUGGUC-3Ј, the 98-mer bottom strand of duplex RNA VS1 [20]: 5Ј-GGGAGUGUGAGGAACUGUUCGGGAGACCUGGAGGCCAGCAGUCGCAAGGCAGAGUACACUAGUCCGAACGUAGUGCUCCCAGGAGCUCAGCUAUCAGA-3Ј, and poly(U) 34-mer: 5Ј-UUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUUU-3Ј These RNA oligonucleotides were 5Ј-end labeled with 32P using T4 polynucleotide kinase (New England BioLabs) and [␥-32P]ATP (150 Ci/l, 6000 Ci/mmol) (PerkinElmer Life Sciences) according to the enzyme manufacturer’s instructions. We incubated various concentrations of protein in a volume of 100 l for 1 h with 0.2 nM labeled RNA oligonucleotide at 37 °C in NS3 helicase assay buffer (25 mM MOPS-NH4ϩ (pH 6.5), 3 mM MgCl2, 1% glycerol, 2 mM dithiothreitol, 30 mM NaCl, 0.2% Triton X-100 (v/v)) before loading onto a membrane sandwich.
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
