Abstract
In the crystal structure of chicken sulfite oxidase, the residue Tyr(322) (Tyr(343) in human sulfite oxidase) was found to directly interact with a bound sulfate molecule and was proposed to have an important role in mediating the substrate specificity and catalytic activity of this molybdoprotein. In order to understand the role of this residue in the catalytic mechanism of sulfite oxidase, steady-state and stopped-flow analyses were performed on wild-type and Y343F human sulfite oxidase over the pH range 6-10. In steady-state assays of Y343F sulfite oxidase using cytochrome c as the electron acceptor, k(cat) was somewhat impaired ( approximately 34% wild-type activity at pH 8.5), whereas the K(m)(sulfite) showed a 5-fold increase over wild type. In rapid kinetic assays of the reductive half-reaction of wild-type human sulfite oxidase, k(red)(heme) changed very little over the entire pH range, with a significant increase in K(d)(sulfite) at high pH. The k(red)(heme) of the Y343F variant was significantly impaired across the entire pH range, and unlike the wild-type protein, both k(red)(heme) and K(d)(sulfite) were dependent on pH, with a significant increase in both kinetic parameters at high pH. Additionally, reduction of the molybdenum center by sulfite was directly measured for the first time in rapid reaction assays using sulfite oxidase lacking the N-terminal heme-containing domain. Reduction of the molybdenum center was quite fast (k(red)(Mo) = 972 s(-1) at pH 8.65 for wild-type protein), indicating that this is not the rate-limiting step in the catalytic cycle. Reduction of the molybdenum center of the Y343F variant by sulfite was more significantly impaired at high pH than at low pH. These results demonstrate that the Tyr(343) residue is important for both substrate binding and oxidation of sulfite by sulfite oxidase.
Highlights
Lybdenum atom coordinated to a pterin derivative through a dithiolene group [4, 5]
Steady-state Kinetic Assays of Wild-type and Y343F Human SO—Based on the crystal structure of chicken SO, Tyr322 was proposed to have an important role in mediating the substrate specificity and catalytic activity of SO [11]
Initial steady-state assays were performed on human SO and the Y343F variant using cyt c as the terminal electron acceptor over the pH range 7–10 for both wild-type and Y343F SO (Table I)
Summary
The Y343F mutation was introduced into the wild-type human SOcontaining plasmid construct pTG918 [28] using the Transformer sitedirected mutagenesis kit (Clontech) with the mutagenic primer (GGCGGGATTTCAAAGGCTTCTC) as described previously [15]. All constructs were verified by sequence analysis performed at the Duke University DNA analysis facility Both recombinant wild-type and Y343F human SO were expressed and purified as previously described [21, 28] with the following modifications. For full-length wild-type human SO and the Y343F variant, rapid kinetic assays of the reductive half-reaction were performed anaerobically at 25 °C using 0.3– 0.8 M protein. Stoppedflow assays were performed anaerobically at 10 °C using 15–18 M protein, and the extinction change was monitored at 355 or 360 nm For both full-length and molybdenum domain assays, the kobs of each individual reaction was obtained by fitting individual kinetic traces to single exponential curves using a nonlinear least-squares Levenberg-. The steady-state reaction parameters kcat and Km were obtained by a direct fit of the concentration dependence to the Michaelis-Menten equation
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
