Abstract
We examined the function of LIP5 in mammalian cells, because the yeast homologue Vta1p was recently identified as a protein required for multivesicular body (MVB) formation. LIP5 is predominantly a cytosolic protein. Depletion of LIP5 by small inhibitory RNA (siRNA) does not affect the distribution or morphology of early endosomes, lysosomes, or Golgi but does reduce the degradation of internalized epidermal growth factor receptor (EGFR), with EGFR accumulating in intracellular vesicles. Depletion of LIP5 by siRNA also decreases human immunodeficiency virus type 1 (HIV-1) budding by 70%. We identify CHMP5 as a LIP5-binding protein and show that CHMP5 is primarily cytosolic. Depletion of CHMP5 by siRNA does not affect the distribution or morphology of early endosomes, lysosomes, or Golgi but does result in reduced degradation of the EGFR similar to silencing of LIP5. Surprisingly, CHMP5 depletion results in an increase in the release of infectious HIV-1 particles. Overexpression of CHMP5 with a large carboxyl-terminal epitope affects the distribution of both early and late endocytic compartments, whereas overexpression of LIP5 does not alter the endocytic pathway. Comparison of overexpression and siRNA phenotypes suggests that the roles of these proteins in MVB formation may be more specifically addressed using RNA interference and that both LIP5 and CHMP5 function in MVB sorting, whereas only LIP5 is required for HIV release.
Highlights
Endosomes play a crucial role in transporting molecules from the plasma membrane to intracellular compartments as well as transporting molecules from the biosynthetic apparatus to their site of action [1,2,3]
The S. cerevisiae homologue of LIP5, Vta1p, is a protein involved in multivesicular body (MVB) formation [17, 18]
E” proteins are required for MVB sorting in S. cerevisiae, and many of these proteins are grouped based on complementation analyses or the complexes in which they are found [4, 34]
Summary
Endosomes play a crucial role in transporting molecules from the plasma membrane to intracellular compartments as well as transporting molecules from the biosynthetic apparatus to their site of action [1,2,3]. Several different endosomal compartments have been described based on morphology, constituents, and role within the endocytic apparatus. The multivesicular body (MVB) is an endosomal compartment that serves to sort membrane proteins destined for degradation or routing to the. Vta1p was shown to play a role in MVB sorting in Saccharomyces cerevisiae, and it was shown that Vta1p interacts with Vps4p [17, 18]. The sequence of LIP5/DRG-1 is homologous to Vta1p; the two proteins show 20.2% identity and 48.9% similarity. We further show that LIP5 interacts with CHMP5/Hspc177, the homologue of the S. cerevisiae class E protein Vps60p [21]. Depletion of CHMP5 by RNA interference alters the degradation of EGFR, but in contrast to LIP5, CHMP5 silencing leads to an increase in HIV particle release. CCGCTCGAGATGGCCGCGCTTGCACCGC CGGGATCCCTATCATTCTCTGCCTGTCGTCAG GAAGATCTATGGCCGCGCTTGCACCGC GGGGTACCTACTACTTGTCATCGTCATCCTTGTAATCGCCGCCTTCTCTGACTGTCGTCAG CGGAATTCATGGACCTATTGTTCGG CGGGATCCCTACTACTTGTCATCGTCATCCTTGTAATCGCCGCCGTCCCTCCGCAGGTTCTTA CGGAATTCATGAGTGGTCTCGGC CGGGATCCCTACTACTTGTCATCGTCATCCTTGTAATCGCCGCCGGATACCCACTCAGCCAA GGAATTCATGAACCGACTCTTCGG CGGGATCCCCTGAAGCAGGGATCTGTGGC CGGGATCCTACTACTTGTCATCGTCATCCTTGTAATCGCCGCCTGAAGCAGGGATCTGTGGC GAATGAAGATCGATAGTAA GCACAGGTGTAGCAAGTAA GGAGAATTATGCTTTGAAA GCAGTGCTTTGCAGTATGA CAGAAAGCCTTGCGAGTTT GAATTTGGATTGCCACAGA GAAGGTGTTCCCACTGATA GAGAGGGTCCTGCAAAGAA Dharmacon control RNA (pool of 4)
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
