Abstract

The NLRP3 inflammasome is a central regulator of inflammation in many common diseases, including atherosclerosis and type 2 diabetes, driving the production of pro-inflammatory mediators such as IL-1β and IL-18. Due to its function as an inflammatory gatekeeper, expression and activation of NLRP3 need to be tightly regulated. In this study, we highlight novel post-transcriptional mechanisms that can modulate NLRP3 expression. We have identified the RNA-binding protein Tristetraprolin (TTP) as a negative regulator of NLRP3 in human macrophages. TTP targets AU-rich elements in the NLRP3 3'-untranslated region (UTR) and represses NLRP3 expression. Knocking down TTP in primary macrophages leads to an increased induction of NLRP3 by LPS, which is also accompanied by increased Caspase-1 and IL-1β cleavage upon NLRP3, but not AIM2 or NLRC4 inflammasome activation. Furthermore, we found that human NLRP3 can be alternatively polyadenylated, producing a short 3'-UTR isoform that excludes regulatory elements, including the TTP- and miRNA-223-binding sites. Because TTP also represses IL-1β expression, it is a dual inhibitor of the IL-1β system, regulating expression of the cytokine and the upstream controller NLRP3.

Highlights

  • The NLRP3 inflammasome is a central regulator of inflammation in many common diseases, including atherosclerosis and type 2 diabetes, driving the production of pro-inflammatory mediators such as IL-1␤ and IL-18

  • During detailed analysis of the human NLRP3 sequence, we noticed that expressed sequence tags (ESTs) indicated alternative 3Ј-ends of transcripts, even though only one 3Ј-untranslated region (UTR) is annotated in RefSeq (Fig. 1a)

  • Polyadenylation sites are located at the 3Ј-end of both isoforms, suggesting that they could arise from alternative polyadenylation

Read more

Summary

Results

The NLRP3 3؅-UTR is alternatively polyadenylated and contains a repressive AU-rich element. To verify expression of the isoforms experimentally, we analyzed expression of NLRP3 in monocytes and macrophages by 3Ј-RACE This successfully amplified two isoforms of the expected lengths, ϳ600 bp for the long and 300 bp for the short isoform (Fig. 1b). A main ARE consisting of three overlapping AUUUA pentamers is present in this region, in close proximity to the target site for miR-223 [15] (supplemental Fig. S2d) These features are only partially conserved in the mouse gene. In agreement with a weak proximal polyadenylation site, we could only detect one isoform of the murine Nlrp3 3Ј-UTR by 3Ј-RACE (supplemental Fig. S2c). Relative NLRP3 mRNA Normalized luciferase expression (relative to empty vector) Relative expression a long: full length short: proximal half end: distal half

AAAAAAAA AAAAAAAA AAAAAAAA
IgG TTP
Relative TNF mRNA
Discussion
Cell culture
Luciferase assay
Western blot
Cell death measurement
GAGCGCGGCGATATCAT GCAACAATATCCACTTTACCAGAGT TGTCCATGGCCACAACAACTGA
RNA immunoprecipitation
Full Text
Paper version not known

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call