Abstract
The tumour suppressor gene (Rb1) is necessary for the maintenance of telomere integrity in osteoblastic cells. We now show that the compaction of telomeric chromatin and the appropriate histone modifications of telomeric DNA are both dependent upon Rb1-mediated transcription of the telomere-derived long non-coding RNA TERRA. Expression of TERRA was reduced in Rb1 haploinsufficient cells, and further decreased by shRNA-mediated reduction of residual Rb1 expression. Restoration of Rb1 levels through lentiviral transduction was sufficient to reestablish both transcription of TERRA and condensation of telomeric chromatin. The human chromosome 15q TERRA promoter contains predicted retinoblastoma control elements, and was able to confer Rb1-dependent transcription upon a promoterless reporter gene. Chromatin immunoprecipitation revealed preferential binding of phosphorylated over non-phosphorylated Rb1 at the TERRA promoter. As Rb1-deficient cells show increased genomic instability we suggest that this novel non-canonical action of Rb1 may contribute to the tumour suppressive actions of Rb1.
Highlights
Osteosarcoma are unusual amongst solid tumours in having a high rate of genomic instability and a propensity for developing at sites of prior radiation exposure[1,2]
Antibody-bound DNA was eluted in H2O and subjected to qPCR analysis using the telomeric primers previously described as well as primers flanking the candidate Retinoblastoma Control Element we identified at the 5′end of the human TERRA promoter region in chromosome 15q homologous to mouse chromosome 18q (Forward: 5′CTGCAACACACGCCCCCC3′and reverse: 3′TAGCATGTGTCTCTGCGCCT5′)
The condensation of telomeric chromatin was assayed by Bal 31 nuclese digestion[20]
Summary
Osteosarcoma are unusual amongst solid tumours in having a high rate of genomic instability and a propensity for developing at sites of prior radiation exposure[1,2]. The correct assembly of shelterin is essential for the organization and stability of telomeric heterochromatic chromatin and the maintainance of telomere length[6] These actions are essential to prevent chromosomal ends from being recognised as DNA double strand breaks and a resultant triggering of an inappropriate DNA damage response. In common with other long-non-coding RNAs11,12 the TERRA RNA is able to co-localize with its transcription site causing it to accumulate at the telomeres[10,13], where TERRA forms hybrid DNA:RNA structures (R-loops)[14,15]. The Rb1-dependent telomeric stability, the interaction between RB1 and SUV39H117, as well as our recent demonstration that the lncRNA PARTICLE forms promoter DNA:RNA hybrids that result in local regulates local epigenetic marks[18], suggest that TERRA may be acting as an Rb1-dependent modulator of telomeric epigenetics. We show that Rb1 influences telomeric integrity through directly regulation of TERRA promoter Rb1-dependent modulation of TERRA transcript levels and that results in structuring of the telomere architecture
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
