The pgdA Gene Encodes for a PeptidoglycanN-Acetylglucosamine Deacetylase in Streptococcus pneumoniae

Waldemar Vollmer,Alexander Tomasz

doi:10.1074/jbc.m910189199

Abstract

Analytical work on the fractionation of the glycan strands of Streptococcus pneumoniae cell wall has led to the observation that an unusually high proportion of hexosamine units (over 80% of the glucosamine and 10% of the muramic acid residues) was not N-acetylated, explaining the resistance of the peptidoglycan to the hydrolytic action of lysozyme, a muramidase that cleaves in the glycan backbone. A gene, pgdA, was identified as encoding for the peptidoglycan N-acetylglucosamine deacetylase A with amino acid sequence similarity to fungal chitin deacetylases and rhizobial NodB chitooligosaccharide deacetylases. Pneumococci in which pgdA was inactivated by insertion duplication mutagenesis produced fully N-acetylated glycan and became hypersensitive to exogenous lysozyme in the stationary phase of growth. The pgdA gene may contribute to pneumococcal virulence by providing protection against host lysozyme, which is known to accumulate in high concentrations at infection sites.

Highlights

The recent introduction of high resolution analytical techniques and genetic approaches began to shed light on the
Analytical work on the fractionation of the glycan strands of Streptococcus pneumoniae cell wall has led to the observation that an unusually high proportion of hexosamine units was not N-acetylated, explaining the resistance of the peptidoglycan to the hydrolytic action of lysozyme, a muramidase that cleaves in the glycan backbone
We show that the innate activity of this enzyme is responsible for the high proportion of non-acetylated hexosamine residues in the peptidoglycan that appears to play a role in the resistance of S. pneumoniae to the activity of exogenous lysozyme, an enzyme that is known to accumulate in high concentrations at infection sites

Summary

EXPERIMENTAL PROCEDURES

Bacterial Strains, Plasmids, and Growth Media—Cultures of S. pneumoniae R36A, a non-encapsulated laboratory strain from the Rockefeller University collection, were grown in a casein-based semi-synthetic medium (C ϩ Y) containing 1 mg/ml yeast extract [7] or in a chemically defined medium (Cden) [8] at 37 °C without aeration. Sequencing of pgdA—A DNA fragment (1801 base pairs) including the pgdA gene was amplified by PCR1 from chromosomal DNA isolated from S. pneumoniae R36A with the primers TCTACAGATACGGATGTTGG and CTATCTTTGATTGCTTGACC using the GeneAmp PCR reagent kit (Perkin-Elmer). An internal fragment of the gene was amplified from chromosomal DNA of strain R36A by PCR using the GeneAmp PCR reagent kit (Perkin-Elmer) with the following primers: 5Ј-GGTGAATTCGGAGTCGTTAATCGTAATGTGACC-3Ј and 5Ј-GGCGGATCCCAACAACATGACCTTCAGATTTTATC-3Ј. With these primers, EcoRI and BamHI restriction sites were introduced. The samples were divided, and one part was N-acetylated with acetic anhydride as described above Both aliquots were reduced with sodium borohydride and analyzed by reversed-phase HPLC on a 3-␮m ODS Hypersil column (Keystone) at 50 °C. The resulting muropeptides were reduced with sodium borohydride and analyzed by reversed-phase HPLC according to Severin et al. using similar conditions as in a published method [21]

RESULTS

Peptidoglycan GlcNAc Deacetylase in Streptococcus pneumoniae

DISCUSSION