The Neuronal Ca2+ Sensor Protein Visinin-like Protein-1 Is Expressed in Pancreatic Islets and Regulates Insulin Secretion

Feihan F Dai,Yi Zhang,Youhou Kang,Qinghua Wang,Herbert Y Gaisano,Karl-Heinz Braunewell,Catherine B Chan,Michael B Wheeler

doi:10.1074/jbc.m512924200

Abstract

Visinin-like protein-1 (VILIP-1) is a member of the neuronal Ca2+ sensor protein family that modulates Ca2+-dependent cell signaling events. VILIP-1, which is expressed primarily in the brain, increases cAMP formation in neural cells by modulating adenylyl cyclase, but its functional role in other tissues remains largely unknown. In this study, we demonstrate that VILIP-1 is expressed in murine pancreatic islets and beta-cells. To gain insight into the functions of VILIP-1 in beta-cells, we used both overexpression and small interfering RNA knockdown strategies. Overexpression of VILIP-1 in the MIN6 beta-cell line or isolated mouse islets had no effect on basal insulin secretion but significantly increased glucose-stimulated insulin secretion. cAMP accumulation was elevated in VILIP-1-overexpressing cells, and the protein kinase A inhibitor H-89 attenuated increased glucose-stimulated insulin secretion. Overexpression of VILIP-1 in isolated mouse beta-cells increased cAMP content accompanied by increased cAMP-responsive element-binding protein gene expression and enhanced exocytosis as detected by cell capacitance measurements. Conversely, VILIP-1 knockdown by small interfering RNA caused a reduction in cAMP accumulation and produced a dramatic increase in preproinsulin mRNA, basal insulin secretion, and total cellular insulin content. The increase in preproinsulin mRNA in these cells was attributed to enhanced insulin gene transcription. Taken together, we have shown that VILIP-1 is expressed in pancreatic beta-cells and modulates insulin secretion. Increased VILIP-1 enhanced insulin secretion in a cAMP-associated manner. Down-regulation of VILIP-1 was accompanied by decreased cAMP accumulation but increased insulin gene transcription.

Highlights

We have shown that Visinin-like protein-1 (VILIP-1) is expressed in pancreatic ␤-cells and modulates insulin secretion
Visinin-like protein-1 (VILIP-1)3 belongs to a family of neuronal Ca2ϩ sensor (NCS) proteins, which are conserved from yeast to human [1]
We identified VILIP-1 in mouse pancreatic islets, and using overexpression and small interfering RNA knockdown strategies, we determined that VILIP-1 can regulate insulin secretion and insulin gene transcription

Summary

MATERIALS AND METHODS

Reagents—The polyclonal antibody to VILIP-1 (rabbit antiserum) and the vector harboring the full-length cDNA of VILIP-1 or the fusion protein VILIP-1-enhanced green fluorescent protein (EGFP) have been described previously [12, 15]. To obtain single islet cells, these intact mouse islets were dispersed in dispase II solution (0.6 –2.4 units/ml) for 5 min and loaded onto glass coverslips after being washed with culture medium. The intact islets and single islet cells were cultured in RPMI 1640 medium containing 11.1 mM glucose supplemented with 10% fetal bovine serum, 10 mM HEPES, 100 units/ml penicillin, and 100 ␮g/ml streptomycin for 24 h before being assayed. The scrambled nonsense siRNA duplex sequences used as a negative control in MIN6 cells were 5Ј-UCAGAGUCUCGCAAUCACGTT-3Ј (sense) and 5Ј-CGUGAUUGCGAGACUCUGATT-3Ј (antisense) as described [25]. Overexpression of VILIP-1 in MIN6 or single islet cells was achieved by transfection of VILIP-1-EGFP using Lipofectamine 2000 [27], and that in intact mouse islets by adenoviral transduction. Primers for real-time PCR PKB, protein kinase B; ERK, extracellular signal-regulated kinase; mTOR, mammalian target of rapamycin

CAGCGCATCCGAGAAACAA GCTTTCCTCCTTGTGCAGGTA CAGCCAAGGTTGTGAGGTTAGG

RESULTS

Previous studies have shown that

PCR on total RNA extracted from