Abstract
Schmallenberg virus (SBV) is transmitted by insect vectors, and therefore vaccination is one of the most important tools of disease control. In our study, novel subunit vaccines on the basis of an amino-terminal domain of SBV Gc of 234 amino acids (“Gc Amino”) first were tested and selected using a lethal small animal challenge model and then the best performing formulations also were tested in cattle. We could show that neither E. coli expressed nor the reduced form of “Gc Amino” protected from SBV infection. In contrast, both, immunization with “Gc Amino”-encoding DNA plasmids and “Gc-amino” expressed in a mammalian system, conferred protection in up to 66% of the animals. Interestingly, the best performance was achieved with a multivalent antigen containing the covalently linked Gc domains of both, SBV and the related Akabane virus. All vaccinated cattle and mice were fully protected against SBV challenge infection. Furthermore, in the absence of antibodies against the viral N-protein, differentiation between vaccinated and field-infected animals allows an SBV marker vaccination concept. Moreover, the presented vaccine design also could be tested for other members of the Simbu serogroup and might allow the inclusion of additional immunogenic domains.
Highlights
The genus Orthobunyavirus which belongs to the family Bunyaviridae, the largest and most diverse family of RNA viruses, comprises more than 350 named isolates divided into 18 serogroups[1], among them the Simbu serogroup
Providing it is immunogenic, such a domain further represents a promising subunit marker vaccine candidate since antibodies against the N protein would be induced by an Schmallenberg virus (SBV) field infection and not by vaccination with the Gc domain, and several validated commercial N-based ELISA tests are available which could be used as companion test system
A PCR product using the plasmid encoding for SBV-Gc Amino as template was generated with the oligonucleotides AATTATTCCATGGGTATCAACTGCAAGAACATCCAGAGCACC and TAATAACTCGAGAATCAGGCTCAGGGTGGTCAGGGTC and subsequently digested with NcoI and XhoI and ligated to the plasmid pGRS-79_Ulm (Roman-Sosa, unpublished) which was treated with these enzymes
Summary
The genus Orthobunyavirus which belongs to the family Bunyaviridae, the largest and most diverse family of RNA viruses, comprises more than 350 named isolates divided into 18 serogroups[1], among them the Simbu serogroup. Recent advances in molecular biology and genetics have enabled various new approaches for the development of safe and effective vaccines such as gene deleted, subunit, live-vectored, or DNA-mediated vaccines which could allow marker strategies For all these approaches the identification of at least one antigen or antigenic domain that stimulates a protective immune response is required[14]. For SBV a major domain connected to virus neutralization has been identified in the M-segment-encoded Gc protein[16] This has been discussed as a possible basis of effective vaccines against SBV as well as against related orthobunyaviruses by using the corresponding genomic regions. Different approaches were selected: (I) DNA immunization; (II) protein expression in E. coli and a mammalian expression system to examine the influence of glycosylation and other posttranslational modifications; (III) immunization with the non-reduced and the reduced form of the protein to evaluate the influence of disulfide bonds; and (IV) the influence of attached domains and thereby potential use as multivalent vaccines
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
