Abstract
Mutant presenilins (PS) contribute to the pathogenesis of familial Alzheimer's disease (FAD) by enhancing the production of Abeta42 from beta-amyloid precursor protein. Presenilins are endoproteolytically processed to N-terminal and C-terminal fragments, which together form a stable 1:1 complex. We have mapped the cleavage site in the PS2 protein by direct sequencing of its C-terminal fragment isolated from mouse liver. Three different N-terminal residues were identified starting at Val-299, Thr-301, and Leu-307 that correspond closely to the previously described N termini of the C-terminal fragment of human PS1. Mutational analysis of the PS2 cleavage site indicates that the principal endoproteolytic cleavage occurs at residues Met-298/Val-299 and that the N terminus is subsequently modified by secondary proteolytic cleavages. We have generated cleavage defective PS2 constructs, which accumulate exclusively as full-length polypeptides in transfected Neuro2a cells. Functional analysis of such cleavage defective PS2 carrying the FAD mutation Asn-141 --> Ile showed that its Abeta42 producing activity was strongly reduced compared with cleavage-competent FAD PS2. In contrast, cleavage defective PS2 was active in rescuing the egg-laying defect of a sel-12 mutant in Caenorhabditis elegans. We conclude that PS2 endoproteolytic cleavage is not an absolute requirement for its activities but may rather selectively enhance or stabilize its functions.
Highlights
The presenilin 1 (PS1)1 and presenilin 2 (PS2) genes are genetically linked to early-onset familial Alzheimer’s disease (FAD) [1,2,3]
Determination of the PS2 Endoproteolytic Cleavage Sites—In order to study the endoproteolytic cleavage of PS2, we analyzed a number of cell lines and tissues for high PS2 expression to facilitate purification and protein chemical characterization of the cleavage site(s)
The PS2 CTFs were subsequently isolated from a pool of 26 mouse livers by immunoaffinity chromatography using monoclonal antibody PST18, which recognizes an epitope on the large hydrophilic loop of murine PS2
Summary
Antibodies—Amino acids 1– 80 of human PS2 (N terminus) and 270 – 387 of murine PS2 (large hydrophilic loop between transmembrane domains 6 and 7) were expressed in Escherichia coli as (NANP) fusion proteins and used for immunization. The C terminus was amplified by primers 5Ј-TATATATCCGGAGCCCTCCAGCTCCCC (sense) and 5Ј-GGTATCTCTAGAGAGTCGACGTGGTACCTCATTATCAGATGTAGAGCTGATGGGAGGCCAGGGTGTC (anti) and AccIII/XbaI-digested Both fragments were ligated into BamHI/ XbaI-restricted pcDNA3.1, and deletion mutagenesis was confirmed by sequencing of the complete insert. The fractions containing the PS2 C-terminal fragment as analyzed by Western blotting were pooled; 10-fold diluted with phosphate buffered saline, 0.25% n-dodecyl ␣-D-maltoside; and re-applied to a fresh PST18 column. The membrane was stained with 0.1% Amido Black in 45% methanol, 7% acetic acid for 10 min, and the bands corresponding to the PS2 C-terminal fragment (as visualized with the polyclonal anti-PS2 hydrophilic loop antibody 53217 on a separate immunoblot) were excised and N-terminally sequenced by Edmann degradation in a ABI 490cLC sequencer. The rescue of the sel-12(ar171) defect by human PS2 wild type and cleavage site mutants was quantified by scoring the egg-laying behavior of transgenic animals [13, 14, 24]
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
