Abstract
A method has been developed to search for the elongation factor Tu (EF-Tu) domain(s) that interact with elongation factor Ts (EF-Ts). This method is based on the suppression of Escherichia coli EF-Tu-dominant negative mutation K136E, a mutation that exerts its effect by sequestering EF-Ts. We have identified nine single-amino acid- substituted suppression mutations in the region 146-199 of EF-Tu. These mutations are R154C, P168L, A174V, K176E, D181G, E190K, D196G, S197F, and I199V. All suppression mutations but one (R154C) significantly affect EF-Tu's ability to interact with EF-Ts under equilibrium conditions. Moreover, with the exception of mutation A174V, the GDP affinity of EF-Tu appears to be relatively unaffected by these mutations. These results suggest that the domain of residues 154 to 199 on EF-Tu is involved in interacting with EF-Ts. These suppression mutations are also capable of suppressing dominant negative mutants N135D and N135I to various degrees. This suggests that dominant negative mutants N135D and N135I are likely to have the same molecular basis as the K136E mutation. The method we have developed in this study is versatile and can be readily adapted to map other regions of EF-Tu. A model of EF-Ts-catalyzed guanine-nucleotide exchange is discussed.
Highlights
R154C, P168LA, 174VK, 176E, DlSlG, E190K, D196G, S197F,and I199V
These results suggest that the domain of residues 154 to 199 on EF-Tu is involved in interacting with elongation factor Ts (EF-Ts)
EF-Tu interacts sequentially with each component of the system during theelongation cycle of protein synthesis to facilitate the bindionfgaminoacyl-tRNA to ribosomes
Summary
For 3H-labeling of EF-Tu, maxicells were prepared using the same procedures except that 3H-labeled amino acid mixture Nitrous acid was used for mutagenesis primarily because of its specificity, which will only generate one nonsense mutation in the 146 to 200 region of EF-Tu. PCR was carried out on 10 ng of DNA template using the GeneAmp kit (Perkin-Elmer Cetus Instruments) exactly as specified by the manufactureTr.w2o1-mer oligonucleotides ity 37 MBq/ml, ICN Biochemicals) was used instead of T r a r ~ - ~ ~ S - label. (TCCGTACATCATCGTGTTCCT)and(GTCTTCGATCGGCAG trapolated from a series of binding assays was used to calculate the CAGGAA) corresponding to amino acid residues 127-134 and 210- relative EF-Ts affinity. Individual ampicillin-resistant colonies were picked (176 from the mutagenized template and 30 from the unmutagenized template which was processed in parallel) and tested on the K medium plate (M9 medium base [40],1%casamino acids, 0.5% glucose, and 1.5%agar) containing 50 pg/ml ampicillin.Twenty-four colonies were selected from the group of cells that were able to grow on the K medium plate, and their suppression sites were identified by DNA sequencing.
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
