Abstract
The reverse transcription process for retroviruses and retrotransposons takes place in a nucleocore structure in the virus or virus-like particle. In retroviruses the major protein of the nucleocore is the nucleocapsid protein (NC protein), which derives from the C-terminal region of GAG. Retroviral NC proteins are formed of either one or two CCHC zinc finger(s) flanked by basic residues and have nucleic acid chaperone and match-maker properties essential for virus replication. Interestingly, the GAG protein of a number of retroelements including Spumaviruses does not possess the hallmarks of retroviral GAGs and in particular lacks a canonical NC protein. In an attempt to search for a nucleic acid chaperone activity in this class of retroelements we used the yeast Ty1 retrotransposon as a model system. Results shows that the C-terminal region of Ty1 GAG contains a nucleic acid chaperone domain capable of promoting the annealing of primer tRNA(i)(Met) to the multipartite primer binding site, Ty1 RNA dimerization and initiation of reverse transcription. Moreover Ty1 RNA dimerization, in a manner similar to Ty3 but unlike retroviral RNAs, appears to be mediated by tRNA(i)(Met). These findings suggest that nucleic acid chaperone proteins probably are general co-factors for reverse transcriptases.
Highlights
The reverse transcription process for retroviruses and retrotransposons takes place in a nucleocore structure in the virus or virus-like particle
Ty1, a yeast LTR retrotransposon distantly related to oncoretroviruses and lentiviruses, encodes a major protein TYA1, considered to be equivalent to retroviral GAG, it lacks most of the hallmarks of GAG
Using an in vitro reconstituted Ty1 replication system, the TYA1-D peptide was able to direct the hybridization of primer tRNAiMet to the multipartite primer binding site (PBS) of Ty1 RNA, allowing elongation of tRNAiMet by reverse transcriptase (RT) (Figs. 4 and 7)
Summary
Plasmid DNAs, RNAs, NC Proteins, and Enzymes—The DNA oligonucleotides used for PCR and plasmid constructions are listed as follows from 5Ј to 3Ј: 1) ggaattcctaatacgactcactataggagaacttctagtat (5ЈTy1); 2) tacaagcttgggctgcagttaacattggtggtg (3ЈTy1); 3) acccaattctcatggggcggcgtgtgcttcggttacttc (5ЈTy1-M2-PBS); 4) agtgagctaacagctgatgaagcag (3ЈTy1-oligo2-PBS); 5) ggaattcctaatacgactcactatagcggcggtggcgcagtg (5ЈtRNAimetKC10Ј); 6) cgggatcccctggggcggcggctcggtttcg (3ЈtRNAimetKC10Ј); 7) cgggatccgaatcccaacaattatctcaacattcac (5ЈTy1A-E2); 8) cgggatccgatgcatttgaaacaaaag (5ЈTy1A-D284); 9) gaagatcttgcaggtgtactgccattatattgc (3ЈTy1A-A283); 10) gaagatctgtgagccctggctgttttc (3ЈTy1A-H401). Bandshift and Sedimentation—32P-Labeled 5ЈTy1 RNA was incubated in presence or absence of the TYA1-D peptide in 10 l of 20 mM Tris1⁄7Cl, pH 7.0, 30 mM NaCl, 0.1 mM MgCl2, 10 M ZnCl2, 5 mM dithiothreitol, and 5 units of RNasin (Promega) for 10 min at 30 °C. Reactions with Ty1 RNA, in vitro synthesized 32P-labeled tRNA, and NC proteins were for 10 min at 30 °C in 10 l containing 20 mM Tris1⁄7Cl, pH 7.5, 30 mM NaCl, 0.2 mM MgCl2, 5 mM dithiothreitol, 0.01 mM ZnCl2, 5 units of RNasin (Promega), 1.5 pmol of RNA, 3 pmol of in vitro synthesized tRNA and NCp7, NCp10, NCp9, or TYA1-D, at the indicated protein to nt molar ratios. Reactions were stopped by SDS/EDTA (0.5%/5 mM final), treated with proteinase K (2 g) for 10 min at room temperature, phenol-chloroform-extracted, and RNA analyzed by 1.3% agarose gel electrophoresis in 50 mM Tris borate, pH 8.3, and visualized by ethidium bromide staining. In the case of self-primed reverse transcription, 32P-tRNA was not used but dNTPs were at 0.25 mM each except for dCTP at 0.01 mM with 2 Ci of [32P]dCTP (Amersham Pharmacia Biotech) per reaction
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
