Abstract
Oxidative stress is a pathological feature of many neurological disorders; therefore, utilizing proteins that are protective against such cellular insults is a potentially valuable therapeutic approach. Oxidation resistance 1 (OXR1) has been shown previously to be critical for oxidative stress resistance in neuronal cells; deletion of this gene causes neurodegeneration in mice, yet conversely, overexpression of OXR1 is protective in cellular and mouse models of amyotrophic lateral sclerosis. However, the molecular mechanisms involved are unclear. OXR1 contains the Tre2/Bub2/Cdc16 (TBC), lysin motif (LysM), domain catalytic (TLDc) domain, a motif present in a family of proteins including TBC1 domain family member 24 (TBC1D24), a protein mutated in a range of disorders characterized by seizures, hearing loss, and neurodegeneration. The TLDc domain is highly conserved across species, although the structure-function relationship is unknown. To understand the role of this domain in the stress response, we carried out systematic analysis of all mammalian TLDc domain-containing proteins, investigating their expression and neuroprotective properties in parallel. In addition, we performed a detailed structural and functional study of this domain in which we identified key residues required for its activity. Finally, we present a new mouse insertional mutant of Oxr1, confirming that specific disruption of the TLDc domain in vivo is sufficient to cause neurodegeneration. Our data demonstrate that the integrity of the TLDc domain is essential for conferring neuroprotection, an important step in understanding the functional significance of all TLDc domain-containing proteins in the cellular stress response and disease.
Highlights
The oxidation resistance 1 (OXR1) gene was originally identified in a screen conducted in Escherichia coli for genes that were able to protect cells against oxidative damage [7]
These data show that Oxr1 and Ncoa7 are expressed throughout the developing embryo, whereas Tbc1d24 expression is more localized to the brain, spinal cord, and liver (Fig. 1C)
We investigated the localization of the TLDc-encoding genes in the adult brain, and we showed that Ncoa7, Oxr1, and Tbc1d24 are expressed in all major structural regions, in the cortex, hippocampus, and cerebellum, with Ncoa7 expression enriched in Purkinje cells as opposed to the cerebellar granule cell layer for Oxr1 and Tbc1d24 (Fig. 1C)
Summary
AGAACATCATCCCTGCATCC CACATTGGGGGTAGGAACA CAGTCGTGACTGGACAGGTTT ATGGGCTACATCTGGAGTCG CCATAAATACACTCTGGTAGTGTCG TTTGGTCGGAAAGATTCAGG TGTCGCTACTTCACTGATGG GCGTCTTTGATCTTCATGTG GCCCCTGGACATTCAGATT CTGTGGGGCTGTAGGATAGG AATGGCCAATGAGAAAGCA AGGGATCCAGGACCAAATG GCAGGCTGAGGTAGACAAG CCCTCTGCATGCCGTTATAC TCAGCTTACAGAAGCTAGCC CTGTCCATCCTGATCTCTGA control of GTP-binding protein ADP-ribosylation factor 6 (ARF6) activation [21, 29] as well as vesicle recycling in neurons [30, 31]. Taken together, these data suggest that OXR1 and TBC1D24 are important for normal brain function. NCOA7 is expressed in the brain [32], nothing is known regarding its transcriptional role in the nervous system To assist these studies, the three-dimensional structure of the TLDc domain has been solved [17]. Our data provide valuable new insight into the function of TLDc domain-containing proteins in the neuronal stress response
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
