Abstract
The dystrophin gene transcription is up-regulated during muscle cell differentiation. Its expression in muscle cells is induced by the binding of the positive regulators serum response factor and dystrophin promoter bending factor (DPBF) on a regulatory CArG element present on the promoter. Here we show that the dystrophin CArG box is also recognized by the zinc finger nuclear factor YY1. Transient transfection experiments show that YY1 negatively regulates dystrophin transcription in C2C12 muscle cells. On the dystrophin CArG element YY1 competes with the structural factor DPBF. We further show that YY1 and DPBF binding to the CArG element induce opposite DNA bends suggesting that their binding induces alternative promoter structures. Along with C2C12 myotube formation YY1 is reduced and we observed that YY1, but not DPBF, is a substrate of m-calpain, a protease that is up-regulated in muscle cell differentiation. Thus, high levels of YY1 in non-differentiated muscle cells down-regulate the dystrophin promoter, at least in part, by interfering with the spatial organization of the promoter.
Highlights
A CArG element was first found in the c-fos promoter where it has been named serum response element (SRE) because of its ability to respond to serum stimulation signaling [6]
YY1 Binds to the CArG Element of the Dystrophin Promoter—The minimal dystrophin promoter transcriptional activation in muscle cells depends on a CArG box, which is in part similar to the c-fos SRE
Both SRE and dystrophin CArG boxes are recognized by serum response factor (SRF) while the ternary complex factor TCF and the bending factor dystrophin promoter bending factor (DPBF) are specific for the SRE and for the dystrophin CArG element, respectively [5]
Summary
Plasmid Construction—To generate the DMD-CAT constructs the dystrophin core promoter was amplified as described previously [5], using the oligonucleotide primers [1] CAGGTCTAGAACACTGAGTGAGTCAACAC and [2] GGATAAGCTTACTCATGTCCTATTATGGGAAACCAACTTGAG for the Ϫ93 DMD-CAT and [1] and [3] GGATAAGCTTGAGAGAGAAGGCGGGTC for Ϫ72 DMD-CAT. The YY1 expression vectors (CMV-YY1 and CMV-ReY) were obtained by cloning the full-length coding sequence of the human YY1 in the pcDNA3 vector (Invitrogen) under control of the cytomegalovirus (CMV) promoter. The GST vector for YY1 expression in Escherichia coli was made by cloning the full-length coding sequence of the human protein downstream from the coding region for the thrombin cleavage site in the pGEX-2T vector (Amersham Pharmacia Biotech). The set of six phasing vectors (FG 277–282) was made by cloning the annealed oligonucleotides [4] AATTCTCATCTCCTATTATGGGAAACCGAGCT and [5] CGGTTTCCCATAATAGGAGATGAG between the SacI and the EcoRI sites of the plasmids pSB-10, -12, -14, -16, -18, and -20 [40], kindly provided by A. All the plasmid structures were verified by sequencing.
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
