Abstract
Bacterial chondroitin polymerase K4CP is a multifunctional enzyme with two active sites. K4CP catalyzes alternative transfers of glucoronic acid (GlcA) and N-acetylgalactosamine (GalNAc) to elongate a chain consisting of the repeated disaccharide sequence GlcAbeta1-3GalNAcbeta1-4. Unlike the polymerization reactions of DNA and RNA and polypeptide synthesis, which depend upon templates, the monosaccharide polymerization by K4CP does not. To investigate the catalytic mechanism of this reaction, we have used isothermal titration calorimetry to determine the binding of the donor substrates UDP-GlcA and UDP-GalNAc to purified K4CP protein and its mutants. Only one donor molecule bound to one molecule of K4CP at a time. UDP-GlcA bound only to the C-terminal active site at a high affinity (K(d)=6.81 microm), thus initiating the polymerization reaction. UDP-GalNAc could bind to either the N-terminal or C-terminal active sites at a low affinity (K(d)=266-283 microm) but not to both sites at the same time. The binding affinity of UDP-GalNAc to a K4CP N-terminal fragment (residues 58-357) was profoundly decreased, yielding the average K(d) value of 23.77 microm, closer to the previously reported K(m) value for the UDP-GalNAc transfer reaction that takes place at the N-terminal active site. Thus, the first step of the reaction appears to be the binding of UDP-GlcA to the C-terminal active site, whereas the second step involves the C-terminal region of the K4CP molecule regulating the binding of UDP-GalNAc to only the N-terminal active site. Alternation of these two specific bindings advances the polymerization reaction by K4CP.
Highlights
Bacterial chondroitin polymerase K4CP is a multifunctional enzyme with two active sites
The Kd values varied from 3.26 to 55.09 M depending upon the temperatures used for the assays, whereas the number of the UDP-glucoronic acid (GlcA) molecules that bound to the K4CP molecule was the same at all temperatures (Table 1)
One UDP molecule was found to bind to the K4CP molecule, which was unexpected given the fact that there are two binding sites for donor substrates. These experimental observations are at first glance puzzling but may provide the insightful clues necessary to understand the catalytic mechanism of the polymerization reaction; both UDP and UDP-glucoronic acid (GlcA) and N-acetylgalactosamine (GalNAc) bind to K4CP at a one to one molecular ratio, and the Kd value of UDP-GalNAc was higher than the reported Km value
Summary
Expression and Purification of Proteins—E. coli BL21 (DE3) cells transformed with pGEX K4CP were grown and harvested as previously reported [17]. Substrate solution was injected into a reaction cell containing the protein. For substrate solutions containing UDP-GlcA, thirty injections of 3 l at 180-s intervals were performed. For substrate solutions containing UDP, UDP-GlcNAc, or UDP-GalNAc, 30 injections of 3 l at 300-s intervals were performed. The pairs of primers used to mutate the DCD-binding motif found in the N terminus region to ACA, DCE, and DCK were: TGGGTTCGGAGCCATAGCACAAGCCAGAATTGCAACATA and TATGTTGCAATTCTGGCTTGTGCTATGGCTCCGAACCCA; TGGGTTCGGAGCCATTTCACAATCCAGAATTGC and GCAATTCTGGATTGTGAAATGGCTCCGAACCCA; and TGGGTTCGGAGCCATTTTACAATCCAGAATTGC and GCAATTCTGGATTGTAAAATGGCTCCGAACCCA, respectively. 53 g of protein were tested in an assay mixture containing 25 mM HEPES (pH 7.5), 100 mM NaCl, 20 mM MnCl2, 1 mM CaCl2, and 1 l of either UDP-[3H]GlcNAc (36.0 Ci/mmol; PerkinElmer Life Sciences), UDP-[3H]GlcA (20.0 Ci/mmol; American Radiolabeled Chemicals, Inc.), or UDP-[3H]GalNAc (20.0 Ci/mmol; American Radiolabeled Chemicals, Inc.). Data analysis was performed using the Origin version 7.0 software programmed to fit data to an s/v-s plot to calculate the Km and Vmax values using Michealis-Menten kinetics
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
