Abstract
[Figure: see text].
Highlights
MethodsThe detailed methods are available in the Data Supplement
Disruption of the DNA-damage response (DDR) pathway led to elevations in inflammatory cytokine production, and the NLRP3 inflammasome was shown to be essential for this augmented cardiac stress response
By employing CRISPR-Cas[9] technology to introduce mutations in exon 6 of the phosphatase Mg2+/Mn2+ dependent 1D (Ppm1d) gene in Hematopoietic stem and progenitor cells (HSPC), we established a mouse model of therapy-related clonal hematopoiesis (t-CH) that recapitulates many of the features observed in individuals with PPM1Dmediated clonal hematopoiesis
Summary
The detailed methods are available in the Data Supplement. The supporting data are available from the corresponding author upon request. Single gRNA targeting mouse Ppm1d (gtcccagctgagatagctag or tggcttaagtcgaagtagcg), nontargeting sgRNA (acggaggctaagcgtcgcaa), or a noncoding sgRNA that targets an intron in the murine Actb gene (aggttgctctgacaaccaca)[24] were subcloned into the BsmB1 restriction enzyme site of the appropriate vector: pLKO5.sgRNA.EFS.tRFP was used for most of the in vivo experiments; pLKO5.sgRNA.EFS.GFP was used for competitive bone marrow transplantation (BMT) experiments; and LentiCRISPRv2GFP was used for cell culture experiments. For Ppm1d expression, the mouse cDNA corresponding to 1 to 1326 base pairs, under the spleen focus forming virus (SFFV) promoter, was subcloned into the lentivirus vector.
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
