Tetrahydrolipstatin Inhibition, Functional Analyses, and Three-dimensional Structure of a Lipase Essential for Mycobacterial Viability

Paul K Crellin,Julian P Vivian,Judith Scoble,Frances M Chow,Nicholas P West,Rajini Brammananth,Nicholas I Proellocks,Adam Shahine,Jerome Le Nours,Matthew C.J Wilce,Warwick J Britton,Ross L Coppel,Jamie Rossjohn,Travis Beddoe

doi:10.1074/jbc.m110.150094

Abstract

The highly complex and unique mycobacterial cell wall is critical to the survival of Mycobacteria in host cells. However, the biosynthetic pathways responsible for its synthesis are, in general, incompletely characterized. Rv3802c from Mycobacterium tuberculosis is a partially characterized phospholipase/thioesterase encoded within a genetic cluster dedicated to the synthesis of core structures of the mycobacterial cell wall, including mycolic acids and arabinogalactan. Enzymatic assays performed with purified recombinant proteins Rv3802c and its close homologs from Mycobacterium smegmatis (MSMEG_6394) and Corynebacterium glutamicum (NCgl2775) show that they all have significant lipase activities that are inhibited by tetrahydrolipstatin, an anti-obesity drug that coincidently inhibits mycobacterial cell wall biosynthesis. The crystal structure of MSMEG_6394, solved to 2.9 Å resolution, revealed an α/β hydrolase fold and a catalytic triad typically present in esterases and lipases. Furthermore, we demonstrate direct evidence of gene essentiality in M. smegmatis and show the structural consequences of loss of MSMEG_6394 function on the cellular integrity of the organism. These findings, combined with the predicted essentiality of Rv3802c in M. tuberculosis, indicate that the Rv3802c family performs a fundamental and indispensable lipase-associated function in mycobacteria.

Highlights

Alence of drug-resistant forms of M. tuberculosis [1]
A key virulence factor is the unique mycobacterial cell wall that consists of a core structure as follows: peptidoglycan covalently linked to arabinogalactan esterified with mycolic acids to form the mycolyl-arabinogalactan-peptidoglycan or “mAGP” complex and a series of free glycolipids, including trehalose monomycolates, trehalose dimycolates, phosphatidylinositol mannosides, and lipoarabinomannans [2], that facilitate vital interactions with host cells to initiate and maintain an infection
A subset of genes required for the late steps of mycolic acid and arabinogalactan biosynthesis are located in proximity to the genomes of mycobacteria and corynebacteria

Summary

MATERIALS AND METHODS

Growth and Manipulation of Escherichia coli and M. smegmatis—E. coli DH5␣ was used for plasmid preparations during cloning experiments, BL21-DE3 was used for protein expression. H37Rv genomic DNA and cloned into an E. coli expression vector (pET19b; Merck). Cytoplasmic, N-terminally His-tagged recombinant protein was expressed in E. coli BL21-DE3 and accumulated in cytoplasmic inclusion bodies following induction with isopropyl 1-thio-␤-D-galactopyranoside (0.5 mM). Recombinant protein was solubilized in urea and purified by immobilized metal ion affinity chromatography before refolding by dialysis into Tris (50 mM, pH 8.0). The MSMEG_6394 gene was amplified by PCR from M. smegmatis genomic DNA using primers A (5Ј-GGAATTGCATATGCGCCGTCCGGACACCCC) and B (5Ј-CCCCAAGCTTCAACCGTGTTTCGGATGGG) and cloned into pET28b (Merck) using NdeI and HindIII (underlined). The recombinant protein was solubilized in buffer A (20 mM Tris-HCl, 0.5 M NaCl, 8 M urea, pH 8.0) and purified by immobilized metal ion affinity chromatography. The NCgl2775 gene was PCR-amplified from C. glutamicum ATCC 13032 genomic DNA using primers C (GGAATTGCATATGTCCGATGACTCAGATTTCATTG) and D (GCCCAAGCTTATCCGTTGTCGATGAGGTTG), digested with NdeI and HindIII (underlined), and cloned into NdeI/HindIII-digested pET28b (Merck).

Data collection

RESULTS

DISCUSSION