Abstract
Objective Tenacissoside H (TDH) is a Chinese medicine monomer extracted from Marsdenia tenacissima extract (MTE), which has been confirmed to have antitumor effects, but its mechanism is still unclear. The aim of this study was to investigate the effect and mechanism of TDH on human colon cancer LoVo cell proliferation and migration and explore the correlation of TDH treatment with the expression of GOLPH3 and cell signaling pathways in LoVo cells. Methods LoVo cells were treated with TDH at 0.1, 1, 10, and 100 μg/mL for 24, 48, and 72 h. The proliferation rate of LoVo cells was evaluated by MTT assay. Recombinant plasmid p-CMV-2-GOLPH3 was constructed, and p-CMV-2-GOLPH3 and p-CMV-2 empty plasmids were transfected into LoVo cells by lipofection. Western blotting was used to detect the transfection efficiency and the expression of p-p70S6K, p70S6K, β-catenin, and GOLPH3. The apoptosis rate was analyzed with Annexin V-FITC/PI double-staining method, and cell migration assessed by transwell assay. Results TDH inhibited the proliferation of LoVo cells in a concentration-dependent manner. The IC50 of TDH treatment in LoVo cells at 24, 48, and 72 h was 40.24, 13.00, and 5.73 μg/mL, respectively. TDH treatment significantly induced apoptosis and suppressed the viability and migration of human colon cancer LoVo cells. The effect of TDH on induction of apoptosis and inhibition of migration in LoVo cells decreased significantly after activating the PI3K/AKT/mTOR and Wnt/β-catenin signaling pathways with agonists. Additionally, the expression of GOLPH3 protein downregulated significantly in LoVo cells under TDH treatment. Overexpression of the GOLPH3 gene increased the expression of key proteins in PI3K/AKT/mTOR and Wnt/β-catenin signaling pathways and blocked the antitumor activity of TDH. Conclusion Collectively, the present results indicated that TDH can inhibit the proliferation vitality of colon cancer LoVo cells through downregulating GOLPH3 expression and activity of PI3K/AKT/mTOR and Wnt/β-catenin signaling pathways.
Highlights
Colon cancer is one of the most common malignant tumors of the digestive tract. e incidence and mortality rate keep increasing worldwide [1]
Construction and identification of recombinant plasmid: total RNA in LoVo cells was extracted and reverse transcribed to obtain cDNA, which was subjected to polymerase chain reaction (PCR) amplification using the following primers: forward, TTTAAGCTTATGACCTCGCTGACCCAGC; reverse, TTTTCTAGATTACTTGGTGAACGCCGCC. e PCR amplification product was a full-length cDNA of 897 bp GOLPH3 full-length cDNA (NM_022130). e PCR product was digested with HindIII and XbaI and ligated into the pFlagCMV-2 vector after double digestion. e clones were selected and verified by sequencing to obtain the GOLPH3 overexpression vector
M. tenacissima is widely used as a traditional Chinese medicine in clinical practice; its preparation Xiaoaiping is used for adjuvant treatment in various malignant tumors; it was interesting to note that the therapeutic effect is remarkable and the adverse reactions are few [11,12,13]. e
Summary
Colon cancer is one of the most common malignant tumors of the digestive tract. e incidence and mortality rate keep increasing worldwide [1]. Colon cancer is one of the most common malignant tumors of the digestive tract. Surgical resection is the most important means of treatment at present. In China, traditional Chinese medicine plays an important role in the adjuvant treatment of malignant tumors. Studies have shown that many Chinese herbal extracts can inhibit tumor growth and improve quality of life [2]. Rough chemical composition analysis and pharmacological studies, it was found that the extract contains different effective chemical ingredients, and the molecular mechanism of its anticancer effect is necessary for further research. Marsdenia tenacissima is the dry vine, root, or leaf of the genus M. tenacissima (Roxb.) Wight et Arn, and the isolated M. tenacissima extract (MTE) causes obvious inhibitory effect on various malignant cells [3].
Sign-in/Register to view highlights & summary Sign-in/Register to access full text options 
Free) 
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a call
