Targeted Melting and Binding of a DNA Regulatory Element by a Transactivator of c-myc

Leonard Bazar,Deborah Meighen,Violaine Harris,Robert Duncan,David Levens,Mark Avigan

doi:10.1074/jbc.270.14.8241

Abstract

A far upstream element (FUSE) of c-myc stimulates promoter activity when bound by a newly identified trans-acting protein, which is expressed in cycling cells. Since FUSE binding protein (FBP) binds only the noncoding strand (NCS) of its regulatory element in a sequence-specific manner, and not double-stranded (ds) DNA, formation of the protein DNA complex in vivo first requires unwinding of the DNA helix. In this report, we show evidence that FBP forces strand separation of short stretches of linear dsDNA. Because FUSE is contained within a region of helical instability that is partially unwound in negatively supercoiled DNA, it is a target for more extensive duplex strand separation by FBP, which first exposes and then selectively binds its NCS cognate sequence. In contrast, other single-stranded DNA binding proteins (SSBs) do not demonstrate this FUSE targeting activity. The novel linkage of regional dsDNA melting with cis-element binding by a transcriptional activator has broad implications in the regulation of eukaryotic gene expression.

Highlights

A far upstream element (FUSE) of e-myc stimulates promoter activity when bound by a newly identified trans-acting protein, which is expressed in cycling cells
Cellular FUSE binding protein (FBP) was initially purified on an affinity column which was linked to double-stranded oligonucleotides encompassing FUSE, it was surprising that both recombinant and purified, cellular FBP bind the noncoding strand (NCS) of FUSE in a single-stranded sequence-specific manner
The mung bean nuclease cleavage products were purified with QIAEX (QIAGEN, Inc.) and digested with Sall or EcoRI to radiolabel the ends of the CS and NCS of c-myc sequences encompassing FUSE, respectively

Summary

EXPERIMENTAL PROCEDURES

DNA Strand Separation of Negatively Supercoiled and Relaxed Forms ofFUSE in the Presence ofRecombinant FBP and Other SSBsGlutathione S-transferase (GST)-FBP was prepared and quantitated, as described previously [4]. The mung bean nuclease cleavage products were purified with QIAEX (QIAGEN, Inc.) and digested with Sall or EcoRI to radiolabel the ends of the CS and NCS of c-myc sequences encompassing FUSE, respectively. After mung bean nuclease cleavage of pFUSE1, the digestion products were cut in the polylinker with SalI, radiolabeled with [y_32P1ATP and T4 polynucleotide kinase (Life Technologies, Inc.), and cleaved, either with HindIII to eliminate the digested vector strand products or with BamHI to eliminate the digested c-myc CS products. To assign the mung bean nuclease digested products to sites of nucleotide cleavage, DNA sequencing reactions were performed by the method of Maxam and Gilbert [9]. Ana lysis of DNA melting a t 37 °C for 16 h was perform ed , as describ ed [10]

RESULTS

E Fuse Binding Protein T4 gene 32 Protein Oligonuc leot ide Competitors

16. AAACGCAAAGAAAATATACAACGGTGGA

DISCUSSION