Subunit Arrangement of γ-Aminobutyric Acid Type A Receptors

Sabine W Baumann,Roland Baur,Erwin Sigel

doi:10.1074/jbc.m105240200

Abstract

The GABA(A) receptors are ligand-gated chloride channels. The subunit stoichiometry of the receptors is controversial; four, five, or six subunits per receptor molecule have been proposed for alphabeta receptors, whereas alphabetagamma receptors are assumed to be pentamers. In this study, alpha-beta and beta-alpha tandem cDNAs from the alpha1 and beta2 subunits of the GABA(A) receptor were constructed. We determined the minimal length of the linker that is required between the two subunits for functional channel expression for each of the tandem constructs. 10- and 23-amino acid residues are required for alpha-beta and beta-alpha, respectively. The tandem constructs either alone or in combination with each other failed to express functional channels in Xenopus oocytes. Therefore, we can exclude tetrameric or hexameric alphabeta GABA(A) receptors. We can also exclude proteolysis of the tandem constructs. In addition, the tandem constructs were combined with single alpha, beta, or gamma subunits to allow formation of pentameric arrangements. In contrast to the combination with alpha subunits, the combination with either beta or gamma subunits led to expression of functional channels. Therefore, a pentameric arrangement containing two alpha1 and three beta2 subunits is proposed for the receptor composed of alpha and beta subunits. Our findings also favor an arrangement betaalphagammabetaalpha for the receptor composed of alpha, beta, and gamma subunits.

Highlights

GABAA receptors composed of ␣ and ␤ subunits differ from receptors that contain the ␥ subunit in regard to Zn2ϩ and benzodiazepine sensitivity and to single channel conductance (9 –13)
We determined the minimal length of the linker that is required between the two subunits for functional channel expression for each of the tandem constructs. 10- and 23-amino acid residues are required for ␣-␤ and ␤-␣, respectively
The tandem constructs were combined with single ␣, ␤, or ␥ subunits to allow formation of pentameric arrangements

Summary

EXPERIMENTAL PROCEDURES

Construction of the Tandem cDNAs—Several ␣-␤ tandem cDNAs encoding a single polypeptide ␣␤ with linkers of differing length were established in the pCMV vector. The ␣1 subunit was amplified by polymerase chain reaction using the pCHAI vector as template and the primers CATAGAAGACACCGGGACGA as a vector-specific primer and XTTGATGTGGTGTGGGGGCTTT as a gene-specific primer The latter was complementary to the last codons before the stop codon and had the first part of the sequence coding for the respective linker attached (X). Subunit Arrangement of GABAA Receptors the primers ACTGACACACATTCCACAGCT as vector-specific primer and YCAGAGTGTCAATGACCCTAGT as a gene-specific primer The latter was complementary to the first codons of the sequence of the mature protein and had the second part of the sequence coding for the respective linker attached (Y). Expression of Tandem Constructs and Wild Type Subunits in Xenopus Oocytes—Capped cRNAs were synthesized (Ambion, Austin, Texas) from the linearized pCMV vectors containing the different tandem constructs, the single ␣1, ␤2, and ␥2 subunits, and from the vector pVA2580 [33] encoding a neuronal voltage-gated sodium channel (Naϩ). Bands were detected using the ECL system (Amersham Pharmacia Biotech)

RESULTS

Number of amino acid residues

DISCUSSION