Abstract
Multisubunit RNA editing complexes catalyze uridylate insertion/deletion RNA editing directed by complementary guide RNAs (gRNAs). Editing in trypanosome mitochondria is transcript-specific and developmentally controlled, but the molecular mechanisms of substrate specificity remain unknown. Here we used a minimal A6 pre-mRNA/gRNA substrate to define functional determinants for full-round insertion and editing complex interactions at the editing site 2 (ES2). Editing begins with pre-mRNA cleavage within an internal loop flanked by upstream and downstream duplexes with gRNA. We found that substrate recognition around the internal loop is sequence-independent and that completely artificial duplexes spanning a single helical turn are functional. Furthermore, after our report of cross-linking interactions at the deletion ES1 (35), we show for the first time editing complex contacts at an insertion ES. Our studies using site-specific ribose 2' substitutions defined 2'-hydroxyls within the (a) gRNA loop region and (b) flanking helixes that markedly stimulate both pre-mRNA cleavage and editing complex interactions at ES2. Modification of the downstream helix affected scissile bond specificity. Notably, a single 2'-hydroxyl at ES2 is essential for cleavage but dispensable for editing complex cross-linking. This study provides new insights on substrate recognition during full-round editing, including the relevance of secondary structure and the first functional association of specific (pre-mRNA and gRNA) riboses with both endonuclease cleavage and cross-linking activities of editing complexes at an ES. Importantly, most observed cross-linking interactions are both conserved and relatively stable at ES2 and ES1 in hybrid substrates. However, they were also detected as transient low-stability contacts in a non-edited transcript.
Highlights
A significant body of information has been accumulated on the functional and structural composition of editing complexes, including the identity of the subunits catalyzing the three steps of each editing cycle; they are mRNA cleavage at deletion and insertion editing sites (ESs) (13, 14), U addition or U removal (15–17), and RNA ligation at deletion and insertion ESs (18 – 23)
We recently reported the first observations of direct editing complex interactions with a functional site for full-round U deletion, showed preferential association with the editing substrate, and provided evidence for one of the interacting subunits corresponding to KREPA2 (Ref. 35)
Analysis of the Natural ATPase 6 (A6) Pre-mRNA Features Proximal to editing site 2 (ES2) for Full-round Insertion—Features in the RNA substrate that are recognized during full-round editing are not fully defined in trypanosomes
Summary
The starting substrate in these studies was the minimized ATPase 6 (A6) 45-nt pre-mRNA (41) paired with a variant of the enhanced gRNA gA6[14]USD-3A (47). This substrate directs full-round insertion of 3Us at ES2 and uses pre-edited ES1 to increase the stability of the downstream duplex. The acceptor pieces were synthesized by IDT, and the thiolated donors were synthesized by Dharmacon. The donor pieces were radiolabeled to high specific activity with T4 polynucleotide kinase and [␥-32P]ATP (MPBiomedicals) using a 1:2 molar ratio of ends:ATP, gel-purified, and ligated to the acceptor piece as described (35) using as the bridge CTATAACTCCAAAATACAGTACTTTCCCTTTC, #553. The molar ratio of acceptor/donor/bridge was 2:1:1.5
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have