Abstract
Here, we explore the regulatory mechanism of lipid metabolic signaling pathways and related genes during differentiation of male germ cells in chickens, with the hope that better understanding of these pathways may improve in vitro induction. Fluorescence-activated cell sorting was used to obtain highly purified cultures of embryonic stem cells (ESCs), primitive germ cells (PGCs), and spermatogonial stem cells (SSCs). The total RNA was then extracted from each type of cell. High-throughput analysis methods (RNA-seq) were used to sequence the transcriptome of these cells. Gene Ontology (GO) analysis and the KEGG database were used to identify lipid metabolism pathways and related genes. Retinoic acid (RA), the end-product of the retinol metabolism pathway, induced in vitro differentiation of ESC into male germ cells. Quantitative real-time PCR (qRT-PCR) was used to detect changes in the expression of the genes involved in the retinol metabolic pathways. From the results of RNA-seq and the database analyses, we concluded that there are 328 genes in 27 lipid metabolic pathways continuously involved in lipid metabolism during the differentiation of ESC into SSC in vivo, including retinol metabolism. Alcohol dehydrogenase 5 (ADH5) and aldehyde dehydrogenase 1 family member A1 (ALDH1A1) are involved in RA synthesis in the cell. ADH5 was specifically expressed in PGC in our experiments and aldehyde dehydrogenase 1 family member A1 (ALDH1A1) persistently increased throughout development. CYP26b1, a member of the cytochrome P450 superfamily, is involved in the degradation of RA. Expression of CYP26b1, in contrast, decreased throughout development. Exogenous RA in the culture medium induced differentiation of ESC to SSC-like cells. The expression patterns of ADH5, ALDH1A1, and CYP26b1 were consistent with RNA-seq results. We conclude that the retinol metabolism pathway plays an important role in the process of chicken male germ cell differentiation.
Highlights
Germ cell differentiation is complex, involving regulation of many genes and cellular regulation pathways
When Aflatoonian and Moore [3] stimulated in vitro human embryonic stem cells to differentiate into sperm, double hydrogen testosterone (DHT) was released into the external medium and Hiibner et al [4] detected estradiol (E2) in the course of inducing mouse embryonic stem cells to differentiate into spermatagonial stem cells
Genomic DNA from embryonic stem cells (ESCs) and primitive germ cells (PGCs) was extracted to identify male and female germ cells through PCR amplification using the primer sequences: F: GTTACTGATTCGTCTACGAGA and R: ATTGAAATGATCCAGTGCTTG in a polymerase chain reaction (PCR) system consisting of thirty cycles of: 98°C for 10 s, 49°C for 5 s, 72°C, for 30 s followed by long-term storage at 4°C
Summary
Germ cell differentiation is complex, involving regulation of many genes and cellular regulation pathways. When Aflatoonian and Moore [3] stimulated in vitro human embryonic stem cells to differentiate into sperm, double hydrogen testosterone (DHT) was released into the external medium and Hiibner et al [4] detected estradiol (E2) in the course of inducing mouse embryonic stem cells to differentiate into spermatagonial stem cells. These studies strongly suggest that lipid metabolism is important in cell differentiation. We have standardized and improved the in vitro culture system for the generation of male germ cells
Sign-in/Register to view highlights & summary Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
Schedule a callDisclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.
