Abstract

A study was conducted to assess the genetic diversity among Simmental Cross cattle in West Sumatra using microsatellite DNA markers. A total of 176 individual cattle blood samples was used for obtaining DNA samples. Twelve primers of microsatellite loci as recommended by FAO were used to identify the genetic diversity of the Simmental Cross cattle population. Multiplex DNA fragment analysis method was used for allele identification. All the microsatellite loci in this study were highly polymorphic and all of the identified alleles were able to classify the cattle population into several groups based on their genetic distance. The heterozygosity values of microsatellite loci in this study ranged from 0.556 to 0.782. The polymorphism information content (PIC) value of the 12 observed loci is high (PIC>0.5). The highest PIC value in the Simmental cattle population was 0.893 (locus TGLA53), while the lowest value was 0.529 (locus BM1818). Based on the genetic distance value, the subpopulation of the Simmental Cross-Agam and the Simmental Cross-Limapuluh Kota was exceptionally close to the Simmental Purebred thus indicating that a grading-up process has taken place with the Simmental Purebred. In view of the advantages possessed by the Simmental Cross cattle and the evaluation of the genetic diversity results, a number of subpopulations in this study can be considered as the initial (base) population for the Simmental Cross cattle breeding programs in West Sumatra, Indonesia.

Highlights

  • The Simmental Cross cattle in West Sumatra mostly originate from the crossing program between the Ongole Grade and the Simmental Purebred sires

  • Submitted Feb. 23, 2015; Revised May 11, 2015; Accepted Jul. 17, 2015 intensively used the Simmental Purebred semen for years resulting in an increased Simmental Cross cattle population in West Sumatra and has generated cattle populations with improved morphological profiles compared to the local cattle (Agung et al, 2014)

  • Blood samples of Simmental Cross cattle were obtained from West Sumatera provinces and Karya Anugerah Rumpin (KAR) Farm in West Java, Indonesia

Read more

Summary

INTRODUCTION

The Simmental Cross cattle in West Sumatra mostly originate from the crossing program between the Ongole Grade (in Indonesia known as Peranakan Ongole [PO]) and the Simmental Purebred sires. Submitted Feb. 23, 2015; Revised May 11, 2015; Accepted Jul. 17, 2015 intensively used the Simmental Purebred semen for years resulting in an increased Simmental Cross cattle population in West Sumatra and has generated cattle populations with improved morphological profiles compared to the local cattle (Agung et al, 2014). This phenomenon inspired the farmers and the local Government to design a breeding program for the Simmental Cross cattle in West Sumatra. This study was conducted to study the genetic diversity in the Simmental Cross cattle in West Sumatra using microsatellite markers as scientific evidence for the latest status of the Simmental Cross cattle in West Sumatra and grouping the Simmental Cross cattle population in West Sumatra that can be used as the initial (base) population for breeding programs

MATERIALS AND METHODS
F: AAAGTGACACAACAGCTTCTCCAG
AND DISCUSSION
CONFLICT OF INTEREST
Full Text
Published version (Free)

Talk to us

Join us for a 30 min session where you can share your feedback and ask us any queries you have

Schedule a call