Abstract
The nucleotide sequence of the 5S rRNA from a mushroom, Coprinus cinereus , was determined to be: pAUCCACGGCCAUACGACUCUGAAAGCACCGCACCGCAUCCCGUCCGAUCUGCGCAGUUAACCAGAGUGCCGCUCAGUUAGUACCACGGUGGGGGACCACGCGGGAAUCCUGGGUGCUGUGGUU. This sequence is consistent with current models for the secondary structure of 5S RNAs and indicates a very high degree of sequence conservation among the most highly evolved fungi. Sequence heterogeneity was not evident in this fungus suggesting that the more highly evolved fungi may not contain the dispersed pattern of 5S rRNA genes which have been observed in intermediate fungi such as Neurospora ( Selker, E.U., and Yanofsky, C. (1981) Cell 24 , 819–828. )
Talk to us
Join us for a 30 min session where you can share your feedback and ask us any queries you have
More From: Biochemical and Biophysical Research Communications
Disclaimer: All third-party content on this website/platform is and will remain the property of their respective owners and is provided on "as is" basis without any warranties, express or implied. Use of third-party content does not indicate any affiliation, sponsorship with or endorsement by them. Any references to third-party content is to identify the corresponding services and shall be considered fair use under The CopyrightLaw.